Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides uniformis ATCC 8492

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides uniformis ATCC 8492
Orthologous TF(s) BACUNI_02075
Regulated genes 5
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides uniformis ATCC 8492
Locus tag Position Score Sequence
Position: -25
Score: 5.6
Sequence: TTAATAACTAATTAAATTAATAT
Locus tag: BACUNI_01022
BACUNI_01022 -25 5.6 TTAATAACTAATTAAATTAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Nan-6
Ortholog function: TonB-dependent outer membrane transporter of sialic acid oligomers
Bacteroides stercoris ATCC 43183 BACSTE_02458 -25 5.3 TAAATAACCAATTAAATTAATAT
Bacteroides uniformis ATCC 8492 BACUNI_01022 -25 5.6 TTAATAACTAATTAAATTAATAT
-21 4.8 TAACTAATTAAATTAATATTTAT
Position: -26
Score: 5
Sequence: ATATTAACAAAATCTTTTAAAGA
Locus tag: BACUNI_01205
BACUNI_01205 -26 5 ATATTAACAAAATCTTTTAAAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: bgaA
Ortholog function: Beta-galactosidase (EC 3.2.1.23)
Bacteroides dorei DSM 17855 BACDOR_00672 -47 4.8 ATTTCAATAAAAACTTTTATTTT
Bacteroides fragilis NCTC 9343 BF1815 -91 5.6 TATATAATAAAATATTTAATTAA
-88 6.1 ATAATAAAATATTTAATTAATAT
-27 5.1 ATATTAATAAATAATAGTATTGA
Bacteroides uniformis ATCC 8492 BACUNI_01205 -26 5 ATATTAACAAAATCTTTTAAAGA
Position: -18
Score: 5.3
Sequence: TTATTAATAATAAATTTTATGAA
Position: -15
Score: 5.1
Sequence: TTAATAATAAATTTTATGAAAAC
Locus tag: BACUNI_01404
BACUNI_01404 -18 5.3 TTATTAATAATAAATTTTATGAA
-15 5.1 TTAATAATAAATTTTATGAAAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagB-II
Ortholog function: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
Bacteroides dorei DSM 17855 BACDOR_00690 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides fragilis NCTC 9343 BF2953 -128 4.8 TAGGTAAAAAAAGATTTTAATTT
Bacteroides uniformis ATCC 8492 BACUNI_01404 -18 5.3 TTATTAATAATAAATTTTATGAA
Bacteroides vulgatus ATCC 8482 BVU_4121 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Position: -47
Score: 5.2
Sequence: ATTATAATAAATAAATTAATTAA
Position: -44
Score: 5.9
Sequence: ATAATAAATAAATTAATTAATTA
Position: -43
Score: 5.2
Sequence: TAATAAATAAATTAATTAATTAA
Position: -40
Score: 5.4
Sequence: TAAATAAATTAATTAATTAATCT
Locus tag: BACUNI_01658
BACUNI_01658 -47 5.2 ATTATAATAAATAAATTAATTAA
-44 5.9 ATAATAAATAAATTAATTAATTA
-43 5.2 TAATAAATAAATTAATTAATTAA
-40 5.4 TAAATAAATTAATTAATTAATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: exbB
Ortholog function: Outer membrane transport system, transport protein ExbB
Bacteroides cellulosilyticus DSM 14838 BACCELL_01010 -44 5.7 ATAATAAACAAATTAATTAATTA
Bacteroides coprophilus DSM 18228 BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Bacteroides eggerthii DSM 20697 BACEGG_00309 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides fragilis NCTC 9343 BF3530 -43 5.5 ATAATAATAATTTAATTAATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides stercoris ATCC 43183 BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides thetaiotaomicron VPI-5482 BT2055 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides uniformis ATCC 8492 BACUNI_01658 -44 5.9 ATAATAAATAAATTAATTAATTA
Position: -194
Score: 4.8
Sequence: ATATAGATATATTTATTAAATAT
Position: -167
Score: 5.7
Sequence: TAATTAATAAAAGATTTTATTAA
Position: -164
Score: 6
Sequence: TTAATAAAAGATTTTATTAATAT
Position: -137
Score: 4.8
Sequence: CCAATAATTAACTTATTTAATTA
Position: -133
Score: 5.5
Sequence: TAATTAACTTATTTAATTAATAT
Position: -52
Score: 5.1
Sequence: AATTTACAAAATTATTTTAGTAT
Locus tag: BACUNI_02075
BACUNI_02075 -194 4.8 ATATAGATATATTTATTAAATAT
-167 5.7 TAATTAATAAAAGATTTTATTAA
-164 6 TTAATAAAAGATTTTATTAATAT
-137 4.8 CCAATAATTAACTTATTTAATTA
-133 5.5 TAATTAACTTATTTAATTAATAT
-52 5.1 AATTTACAAAATTATTTTAGTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanR
Ortholog function: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04950 -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides dorei DSM 17855 BACDOR_00695 -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697 BACEGG_02291 -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343 BF1711 -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483 BACOVA_01791 -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135 BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Bacteroides stercoris ATCC 43183 BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482 BT0433 -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492 BACUNI_02075 -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482 BVU_4116 -190 5.5 AAACTAAATTTATTTATTAATAA