Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of PerR regulog to Bacteroides fragilis NCTC 9343

Reference regulog properties
Source regulog: PerR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides fragilis NCTC 9343
Orthologous TF(s) BF3019
Regulated genes 3
Built upon 51 sites [see more]
Predicted regulatory interactions in Bacteroides fragilis NCTC 9343
Locus tag Position Score Sequence
Position: -86
Score: 6.2
Sequence: AAAATTGTATTTAATACAAATTA
Locus tag: BF2364
BF2364 -86 6.2 AAAATTGTATTTAATACAAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF05140
Ortholog function: ResB protein required for cytochrome c biosynthesis
Bacteroides fragilis NCTC 9343 BF2364 -86 6.2 AAAATTGTATTTAATACAAATTA
Bacteroides thetaiotaomicron VPI-5482 BT1604 -94 6.1 CTACTTGTAACGATTACAATTTT
Position: -39
Score: 6.8
Sequence: AAAATTGTAATGAATACAATTTT
Locus tag: BF3019
BF3019 -39 6.8 AAAATTGTAATGAATACAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: perR
Ortholog function: Peroxide stress regulator PerR, Fur family
Bacteroides cellulosilyticus DSM 14838 BACCELL_05678 -36 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides dorei DSM 17855 BACDOR_03683 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides eggerthii DSM 20697 BACEGG_01512 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides fragilis NCTC 9343 BF3019 -39 6.8 AAAATTGTAATGAATACAATTTT
Bacteroides plebeius DSM 17135 BACPLE_02660 -33 5.9 AGAATTGTAACAATTACATAATT
Bacteroides stercoris ATCC 43183 BACSTE_01825 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides uniformis ATCC 8492 BACUNI_01378 -38 6.6 AAAAATGTAATAATTACAAGTTT
Bacteroides vulgatus ATCC 8482 BVU_2366 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides coprophilus DSM 18228 BACCOPRO_01403 -33 6.1 AAAATTGTAATAGTTACAGAATT
Position: -36
Score: 5.9
Sequence: ATATTTGCAATAATTATAAATAT
Locus tag: BF3647
BF3647 -36 5.9 ATATTTGCAATAATTATAAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF01637
Ortholog function: Archaeal ATPase family protein
Bacteroides fragilis NCTC 9343 BF3647 -36 5.9 ATATTTGCAATAATTATAAATAT
Bacteroides ovatus ATCC 8483 BACOVA_02789 -33 5.6 ATATTTGTAATAATTGTATTTAT