Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides fragilis NCTC 9343

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides fragilis NCTC 9343
Orthologous TF(s) BF1711
Regulated genes 8
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides fragilis NCTC 9343
Locus tag Position Score Sequence
Position: -282
Score: 4.7
Sequence: ATATTAATGATATAGATTTTTAA
Position: -279
Score: 5.3
Sequence: TTAATGATATAGATTTTTAATAT
Position: -173
Score: 5.5
Sequence: CATATAATAAAATATTTTATTAA
Position: -170
Score: 6.3
Sequence: ATAATAAAATATTTTATTAATAA
Position: -52
Score: 4.8
Sequence: TTAATAAACAAATTAACTATCTT
Locus tag: BF1711
BF1711 -282 4.7 ATATTAATGATATAGATTTTTAA
-279 5.3 TTAATGATATAGATTTTTAATAT
-173 5.5 CATATAATAAAATATTTTATTAA
-170 6.3 ATAATAAAATATTTTATTAATAA
-52 4.8 TTAATAAACAAATTAACTATCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanR
Ortholog function: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04950 -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides dorei DSM 17855 BACDOR_00695 -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697 BACEGG_02291 -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343 BF1711 -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483 BACOVA_01791 -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135 BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Bacteroides stercoris ATCC 43183 BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482 BT0433 -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492 BACUNI_02075 -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482 BVU_4116 -190 5.5 AAACTAAATTTATTTATTAATAA
Position: -268
Score: 4.8
Sequence: AAGATAGTTAATTTGTTTATTAA
Position: -150
Score: 6.3
Sequence: TTATTAATAAAATATTTTATTAT
Position: -147
Score: 5.5
Sequence: TTAATAAAATATTTTATTATATG
Position: -41
Score: 5.3
Sequence: ATATTAAAAATCTATATCATTAA
Locus tag: BF1712
BF1712 -268 4.8 AAGATAGTTAATTTGTTTATTAA
-150 6.3 TTATTAATAAAATATTTTATTAT
-147 5.5 TTAATAAAATATTTTATTATATG
-41 5.3 ATATTAAAAATCTATATCATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Bacteroides coprophilus DSM 18228 BACCOPRO_02518 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855 BACDOR_00694 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides eggerthii DSM 20697 BACEGG_02294 -85 6 TTAATAAAATAATTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1712 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00275 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01905 -94 5.8 TATTTAATAAAATAAATTATTAA
Bacteroides vulgatus ATCC 8482 BVU_4117 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Position: -39
Score: 5.3
Sequence: ATTATAATTTTCTTTATTATTAA
Locus tag: BF1719
BF1719 -39 5.3 ATTATAATTTTCTTTATTATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Nan-5
Ortholog function: TonB-dependent outer membrane transporter of sialic acid oligomers
Bacteroides dorei DSM 17855 BACDOR_01206 -163 4.8 GTTATAATAAAATATTTTTGTTT
-160 5 ATAATAAAATATTTTTGTTTATA
Bacteroides fragilis NCTC 9343 BF1719 -39 5.3 ATTATAATTTTCTTTATTATTAA
Bacteroides plebeius DSM 17135 BACPLE_00590 -267 5.2 TATATAAATAATATTTTTATCAT
-156 5 TTCATAAAATATTTTATCAAATA
Bacteroides vulgatus ATCC 8482 BVU_2432 -92 6.1 TTTTTAATAAATTATTTTATTAA
Position: -21
Score: 5.3
Sequence: TATTTAATATAATTATATAATAT
Locus tag: BF1796
BF1796 -21 5.3 TATTTAATATAATTATATAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fucA
Ortholog function: Alpha-L-fucosidase (EC 3.2.1.51)
Bacteroides fragilis NCTC 9343 BF1796 -21 5.3 TATTTAATATAATTATATAATAT
Bacteroides vulgatus ATCC 8482 BVU_2433 -92 6.1 TTTTTAATAAATTATTTTATTAA
Position: -88
Score: 6.1
Sequence: ATAATAAAATATTTAATTAATAT
Locus tag: BF1806
BF1806 -88 6.1 ATAATAAAATATTTAATTAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanH
Ortholog function: Sialidase (EC 3.2.1.18)
Bacteroides coprophilus DSM 18228 BACCOPRO_02522 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1806 -91 5.6 TATATAATAAAATATTTAATTAA
-88 6.1 ATAATAAAATATTTAATTAATAT
-27 5.1 ATATTAATAAATAATAGTATTGA
Position: -27
Score: 5.1
Sequence: ATATTAATAAATAATAGTATTGA
Locus tag: BF1814
BF1814 -27 5.1 ATATTAATAAATAATAGTATTGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manA
Ortholog function: Alpha-1,2-mannosidase
Bacteroides dorei DSM 17855 BACDOR_00671 -47 4.8 ATTTCAATAAAAACTTTTATTTT
Bacteroides fragilis NCTC 9343 BF1814 -91 5.6 TATATAATAAAATATTTAATTAA
-88 6.1 ATAATAAAATATTTAATTAATAT
-27 5.1 ATATTAATAAATAATAGTATTGA
Position: -128
Score: 4.8
Sequence: TAGGTAAAAAAAGATTTTAATTT
Position: -123
Score: 4.7
Sequence: AAAAAAAGATTTTAATTTAATTT
Locus tag: BF2953
BF2953 -128 4.8 TAGGTAAAAAAAGATTTTAATTT
-123 4.7 AAAAAAAGATTTTAATTTAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagB-II
Ortholog function: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) / putative N-acetylglucosaminylphosphatidylinositol de-N-acetylase ( EC:3.5.1.89)
Bacteroides dorei DSM 17855 BACDOR_00690 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides fragilis NCTC 9343 BF2953 -128 4.8 TAGGTAAAAAAAGATTTTAATTT
Bacteroides uniformis ATCC 8492 BACUNI_01404 -18 5.3 TTATTAATAATAAATTTTATGAA
Bacteroides vulgatus ATCC 8482 BVU_4121 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Position: -320
Score: 4.9
Sequence: AAGATTTTAAATTTTATTAATTT
Position: -307
Score: 4.9
Sequence: TTATTAATTTAGTTGATTTATTA
Position: -48
Score: 4.8
Sequence: ATACAATAATAATAATTTAATTA
Position: -43
Score: 5.5
Sequence: ATAATAATAATTTAATTAATTAA
Position: -40
Score: 5.4
Sequence: ATAATAATTTAATTAATTAATCT
Locus tag: BF3530
BF3530 -320 4.9 AAGATTTTAAATTTTATTAATTT
-307 4.9 TTATTAATTTAGTTGATTTATTA
-48 4.8 ATACAATAATAATAATTTAATTA
-43 5.5 ATAATAATAATTTAATTAATTAA
-40 5.4 ATAATAATTTAATTAATTAATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: exbB
Ortholog function: Outer membrane transport system, transport protein ExbB
Bacteroides cellulosilyticus DSM 14838 BACCELL_01010 -44 5.7 ATAATAAACAAATTAATTAATTA
Bacteroides coprophilus DSM 18228 BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Bacteroides eggerthii DSM 20697 BACEGG_00309 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides fragilis NCTC 9343 BF3530 -43 5.5 ATAATAATAATTTAATTAATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides stercoris ATCC 43183 BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides thetaiotaomicron VPI-5482 BT2055 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides uniformis ATCC 8492 BACUNI_01658 -44 5.9 ATAATAAATAAATTAATTAATTA