Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Crp regulog to Bacteroides fragilis NCTC 9343

Reference regulog properties
Source regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides fragilis NCTC 9343
Orthologous TF(s) BF0954
Regulated genes 10
Built upon 113 sites [see more]
Predicted regulatory interactions in Bacteroides fragilis NCTC 9343
Locus tag Position Score Sequence
Position: -114
Score: 5.6
Locus tag: BF0210
Supported by regulated orthologs from reference regulons
Ortholog gene name: fucR
Ortholog function: Transcriptional regulator of fucose utilization, GntR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04988 -124 5.2 TTATATGCTGCAAAACATATCC
Bacteroides dorei DSM 17855 BACDOR_02265 -114 5.1 TCTTGTGTTATAAAACATACCA
Bacteroides fragilis NCTC 9343 BF0210 -114 5.6 TTTGATGTTGTATAACATACCA
Bacteroides ovatus ATCC 8483 BACOVA_03849 -100 5.8 TTTTCTGCTATAAAACATATCA
Bacteroides plebeius DSM 17135 BACPLE_02898 -93 4.6 AAATCTGTTCTTAAACATAGCT
Bacteroides thetaiotaomicron VPI-5482 BT1272 -100 5.5 TTTCCTGCTATAGAACATATTA
Bacteroides vulgatus ATCC 8482 BVU_1374 -114 5 TCTTGTGTTATAAAACATACCT
Position: -90
Score: 5.7
Locus tag: BF0315
Supported by regulated orthologs from reference regulons
Ortholog gene name: BT1272
Ortholog function: Transcriptional regulator, GntR family
Bacteroides fragilis NCTC 9343 BF0315 -90 5.7 TATTATGTTACAAAACATATAC
Bacteroides thetaiotaomicron VPI-5482 BT2096 -77 4.8 CTGTATGTTGTAAAACACATAC
Position: -143
Score: 5.7
Locus tag: BF0316
Supported by regulated orthologs from reference regulons
Ortholog gene name: COG3533
Ortholog function: Six-hairpin glycosidase-like, COG3533 family
Bacteroides fragilis NCTC 9343 BF0316 -143 5.7 GTATATGTTTTGTAACATAATA
Position: -162
Score: 5.4
Locus tag: BF0594
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Crp-4
Ortholog function: TonB-dependent outer membrane transporter of oligosaccharides
Bacteroides fragilis NCTC 9343 BF0594 -162 5.4 TTCTATGTTATTAGACATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_00464 -162 5.3 AAACATGCTATTCAGCATAAAA
Position: -33
Score: 4.6
Locus tag: BF0954
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: transcriptional regulator, Crp/Fnr family
Bacteroides cellulosilyticus DSM 14838 BACCELL_03476 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855 BACDOR_01607 -35 4.1 ATTTGTGCTCTATAACACGGTT
Bacteroides eggerthii DSM 20697 BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides fragilis NCTC 9343 BF0954 -33 4.6 ATTTGTGCTTTATAACACAGTT
Bacteroides ovatus ATCC 8483 BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides plebeius DSM 17135 BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183 BACSTE_03515 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482 BT4338 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides uniformis ATCC 8492 BACUNI_04721 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides vulgatus ATCC 8482 BVU_3580 -35 4.1 ATTTGTGCTCTATAACACGGTT
Position: -81
Score: 4.6
Locus tag: BF2354
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylR
Ortholog function: Predicted regulator of xylose utilization, NrtR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04758 -83 4.9 AATAGTGCTTTATAACATAATA
Bacteroides dorei DSM 17855 BACDOR_00865 -34 4.8 AATAGTGTTTTAGAACATAATA
Bacteroides eggerthii DSM 20697 BACEGG_02642 -92 4.8 AATAATGCTTTGTAACATATCA
Bacteroides fragilis NCTC 9343 BF2354 -81 4.6 AACAATGCTTTATAGCATATTA
Bacteroides ovatus ATCC 8483 BACOVA_02532 -80 4.2 AACAATGTTTTATAGCATGTTT
Bacteroides stercoris ATCC 43183 BACSTE_01380 -92 4.3 AATAATGCTTTATAACATTGTA
Bacteroides thetaiotaomicron VPI-5482 BT0791 -81 4.2 AACAATGTTTTATAGCATGTCA
Bacteroides uniformis ATCC 8492 BACUNI_00695 -92 4.1 AATAATGCTTTATAATATTATA
Bacteroides vulgatus ATCC 8482 BVU_3955 -100 4.5 AATAGTGTTTTGGAACATAATA
Position: -71
Score: 6.2
Locus tag: BF2389
Supported by regulated orthologs from reference regulons
Ortholog gene name: serB
Ortholog function: Phosphoserine phosphatase (EC
Bacteroides cellulosilyticus DSM 14838 BACCELL_04825 -163 5.5 TTTCATGTTATATAACATGTTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01694 -134 5.6 AATTATGCTTTTAAACATAAAT
Bacteroides dorei DSM 17855 BACDOR_02848 -116 6.1 AAATATGTTATATAGCATAAAA
Bacteroides eggerthii DSM 20697 BACEGG_02676 -74 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides fragilis NCTC 9343 BF2389 -71 6.2 TTTTATGTTATTTAGCATAAAT
Bacteroides ovatus ATCC 8483 BACOVA_02567 -66 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_01424 -74 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides thetaiotaomicron VPI-5482 BT0832 -67 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_00649 -75 6.2 TTTTATGTTATTTAGCATAAAT
Bacteroides vulgatus ATCC 8482 BVU_3158 -116 6.1 AAATATGTTATATAGCATAAAA
Position: -99
Score: 5.9
Locus tag: BF2582
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF09719
Ortholog function: Putative redox-active protein (C_GCAxxG_C_C)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04404 -142 5.6 TTTTATGACATATAACATAAAA
Bacteroides dorei DSM 17855 BACDOR_00927 -110 4.6 AAAAGTGTTGAATAACATAATT
Bacteroides eggerthii DSM 20697 BACEGG_02494 -109 5.6 TAACGTGTTATATAACATAAAA
Bacteroides fragilis NCTC 9343 BF2582 -99 5.9 TAATCTGTTATATAACATAATT
Bacteroides ovatus ATCC 8483 BACOVA_02257 -107 5.3 TAAAGTGTTATATAACATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_01186 -110 5.4 TAACGTGCTATATAACATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_02281 -105 5.3 TAACGTGTTGTATAACATAAAT
Bacteroides vulgatus ATCC 8482 BVU_3908 -104 4.6 AAAAGTGTTGAATAACATAATT
Position: -151
Score: 6
Locus tag: BF3646
Supported by regulated orthologs from reference regulons
Ortholog gene name: BACCELL_00794
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838 BACCELL_00794 -135 6.1 TTTTATGTTATAAAACATATTT
Bacteroides dorei DSM 17855 BACDOR_04003 -33 4.5 TTTTAGGTTTAACAAATTAAAA
Bacteroides eggerthii DSM 20697 BACEGG_00156 -129 5.5 TTTTGTGTTATAAAACATATTC
Bacteroides fragilis NCTC 9343 BF3646 -151 6 TTTTATGTTGAATAACATATTT
Bacteroides ovatus ATCC 8483 BACOVA_03166 -135 5.8 TTTTATGCTATAAAACATATTC
Bacteroides plebeius DSM 17135 BACPLE_00736 -116 5.5 TTTTATGTTATCCAACATATTC
Bacteroides stercoris ATCC 43183 BACSTE_03638 -132 5.7 TTTTGTGTTATAAAACATAATC
Bacteroides thetaiotaomicron VPI-5482 BT2178 -135 5.4 TTTTATGCTATAAAACATATCG
Bacteroides uniformis ATCC 8492 BACUNI_03316 -125 5.7 TTTTGTGTTATAAAACATATAC
Bacteroides vulgatus ATCC 8482 BVU_2553 -33 4.5 TTTTAGGTTTAACAAATTAAAA
Position: -227
Score: 5
Position: -105
Score: 5.7
Locus tag: BF4221
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF01694
Ortholog function: Peptidase S54, rhomboid domain
Bacteroides cellulosilyticus DSM 14838 BACCELL_02471 -196 5 TAATATGTTACACAAAAGATAT
Bacteroides dorei DSM 17855 BACDOR_01705 -71 6.2 TTTTCTGTTATATAACAGAATA
Bacteroides eggerthii DSM 20697 BACEGG_03101 -188 5.3 TAATATGTTACACAAAAGAAAA
Bacteroides fragilis NCTC 9343 BF4221 -227 5 ATATATGTTACACAAAAGATAT
Bacteroides ovatus ATCC 8483 BACOVA_02079 -195 5 ATATATGTTACACAAAAGATTA
Bacteroides stercoris ATCC 43183 BACSTE_02140 -188 4.3 TTAATTGTTACACAAAAGAAAA
Bacteroides thetaiotaomicron VPI-5482 BT2831 -192 4.9 ATATATGTTACACAAAAGATTT
Bacteroides uniformis ATCC 8492 BACUNI_03999 -230 5 TAATATGTTACACAAAAGATAT
Bacteroides vulgatus ATCC 8482 BVU_0995 -71 6.2 TTTTCTGTTATATAACAGAATA