Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of HTCS_Ara-1 regulog to Bacteroides plebeius DSM 17135

Reference regulog properties
Source regulog: HTCS_Ara-1 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides plebeius DSM 17135
Orthologous TF(s) No orthologous TFs found
Regulated genes 2
Built upon 12 sites [see more]
Predicted regulatory interactions in Bacteroides plebeius DSM 17135
Locus tag Position Score Sequence
Position: -153
Score: 6.8
Sequence: TGTCCACCCAATAGAAAAATTTGTCCACCT
Locus tag: BACPLE_00641
BACPLE_00641 -153 6.8 TGTCCACCCAATAGAAAAATTTGTCCACCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: abf2
Ortholog function: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Bacteroides cellulosilyticus DSM 14838 BACCELL_05303 -268 7.8 TGTCCACCTCAAATGTTCATTTGTCCACCT
Bacteroides dorei DSM 17855 BACDOR_01715 -159 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT
Bacteroides eggerthii DSM 20697 BACEGG_01543 -285 7.4 TGTCCACCTTAAAAGGTCATATATCCACCT
Bacteroides plebeius DSM 17135 BACPLE_00641 -153 6.8 TGTCCACCCAATAGAAAAATTTGTCCACCT
Bacteroides thetaiotaomicron VPI-5482 BT0368 -69 7 TGTCCACCAATCGTGTTCGTATGTCCACCT
Bacteroides vulgatus ATCC 8482 BVU_1001 -169 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT
Position: -224
Score: 7.8
Sequence: TATCCACCTATAAAATTCGTTTGTCCACCT
Locus tag: BACPLE_00643
BACPLE_00643 -224 7.8 TATCCACCTATAAAATTCGTTTGTCCACCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Ara-3
Ortholog function: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Bacteroides dorei DSM 17855 BACDOR_01719 -291 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC
Bacteroides eggerthii DSM 20697 BACEGG_01540 -349 6.4 TCTCTACACTTAAAATTCGTTTATCCACCT
-328 7.3 TATCCACCTCTAAAACCCATTTGTCCACCC
Bacteroides plebeius DSM 17135 BACPLE_00643 -224 7.8 TATCCACCTATAAAATTCGTTTGTCCACCT
Bacteroides vulgatus ATCC 8482 BVU_1005 -265 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC