Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of PerR regulog to Bacteroides plebeius DSM 17135

Reference regulog properties
Source regulog: PerR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides plebeius DSM 17135
Orthologous TF(s) BACPLE_02660
Regulated genes 5
Built upon 51 sites [see more]
Predicted regulatory interactions in Bacteroides plebeius DSM 17135
Locus tag Position Score Sequence
Position: -94
Score: 6.7
Sequence: AAAATTGTAATGATTTCAAATTT
Locus tag: BACPLE_00297
BACPLE_00297 -94 6.7 AAAATTGTAATGATTTCAAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbr2
Ortholog function: Rubrerythrin
Bacteroides dorei DSM 17855 BACDOR_01950 -93 6.7 ATAATTGTAATGAATACAATTTT
Bacteroides plebeius DSM 17135 BACPLE_00297 -94 6.7 AAAATTGTAATGATTTCAAATTT
Bacteroides vulgatus ATCC 8482 BVU_1137 -92 6.4 GTAATTGTAATAAATACAATTTT
Position: -33
Score: 5.9
Sequence: AGAATTGTAACAATTACATAATT
Locus tag: BACPLE_02660
BACPLE_02660 -33 5.9 AGAATTGTAACAATTACATAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: perR
Ortholog function: Peroxide stress regulator PerR, Fur family
Bacteroides cellulosilyticus DSM 14838 BACCELL_05678 -36 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides dorei DSM 17855 BACDOR_03683 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides eggerthii DSM 20697 BACEGG_01512 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides fragilis NCTC 9343 BF3019 -39 6.8 AAAATTGTAATGAATACAATTTT
Bacteroides plebeius DSM 17135 BACPLE_02660 -33 5.9 AGAATTGTAACAATTACATAATT
Bacteroides stercoris ATCC 43183 BACSTE_01825 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides uniformis ATCC 8492 BACUNI_01378 -38 6.6 AAAAATGTAATAATTACAAGTTT
Bacteroides vulgatus ATCC 8482 BVU_2366 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides coprophilus DSM 18228 BACCOPRO_01403 -33 6.1 AAAATTGTAATAGTTACAGAATT
Position: -28
Score: 5.5
Sequence: TACTTTGTAATCATTATAAAAAT
Locus tag: BACPLE_02813
BACPLE_02813 -28 5.5 TACTTTGTAATCATTATAAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: BT1211
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838 BACCELL_04244 -29 6.5 ATATTTGTAATGATTATAAATTT
Bacteroides dorei DSM 17855 BACDOR_04415 -34 5.9 TTCTTTGTAATTATTACAACTTT
Bacteroides eggerthii DSM 20697 BACEGG_02389 -30 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides ovatus ATCC 8483 BACOVA_03967 -35 6.2 ATATTTGTACTCATTACAAATTA
Bacteroides plebeius DSM 17135 BACPLE_02813 -28 5.5 TACTTTGTAATCATTATAAAAAT
Bacteroides stercoris ATCC 43183 BACSTE_00833 -29 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides thetaiotaomicron VPI-5482 BT1211 -35 6.2 ATATTTGTACTCATTACAAATTC
Bacteroides uniformis ATCC 8492 BACUNI_02171 70 6.5 ATATTTGTAATCATTATAATTTT
Bacteroides coprophilus DSM 18228 BACCOPRO_00522 -28 5.2 TCCTTTGTAATTATTATAAAAAT
Position: -79
Score: 5.9
Sequence: AGATTTGTTATCTTTACAATTTT
Locus tag: BACPLE_02893
BACPLE_02893 -79 5.9 AGATTTGTTATCTTTACAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF05140
Ortholog function: ResB protein required for cytochrome c biosynthesis
Bacteroides plebeius DSM 17135 BACPLE_02893 -79 5.9 AGATTTGTTATCTTTACAATTTT
Bacteroides coprophilus DSM 18228 BACCOPRO_00708 -79 6 ACAATTGTTATCTTTACAATTTT
Position: -50
Score: 6.1
Sequence: ATATTTGTAATTGTTACAATCTT
Locus tag: BACPLE_03494
BACPLE_03494 -50 6.1 ATATTTGTAATTGTTACAATCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF00576
Ortholog function: Transthyretin family protein
Bacteroides plebeius DSM 17135 BACPLE_03494 -50 6.1 ATATTTGTAATTGTTACAATCTT