Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides plebeius DSM 17135

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides plebeius DSM 17135
Orthologous TF(s) BACPLE_00597
Regulated genes 7
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides plebeius DSM 17135
Locus tag Position Score Sequence
Position: -267
Score: 5.2
Sequence: TATATAAATAATATTTTTATCAT
Position: -156
Score: 5
Sequence: TTCATAAAATATTTTATCAAATA
Locus tag: BACPLE_00590
BACPLE_00590 -267 5.2 TATATAAATAATATTTTTATCAT
-156 5 TTCATAAAATATTTTATCAAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Nan-5
Ortholog function: TonB-dependent outer membrane transporter of sialic acid oligomers
Bacteroides dorei DSM 17855 BACDOR_01206 -163 4.8 GTTATAATAAAATATTTTTGTTT
-160 5 ATAATAAAATATTTTTGTTTATA
Bacteroides fragilis NCTC 9343 BF1719 -39 5.3 ATTATAATTTTCTTTATTATTAA
Bacteroides plebeius DSM 17135 BACPLE_00590 -267 5.2 TATATAAATAATATTTTTATCAT
-156 5 TTCATAAAATATTTTATCAAATA
Bacteroides vulgatus ATCC 8482 BVU_2432 -92 6.1 TTTTTAATAAATTATTTTATTAA
Position: -33
Score: 5
Sequence: TATTAAATAAACTAATTTATTAA
Position: -30
Score: 5.5
Sequence: TAAATAAACTAATTTATTAAATA
Position: -21
Score: 5.2
Sequence: TAATTTATTAAATATAATATTAT
Locus tag: BACPLE_00595
BACPLE_00595 -33 5 TATTAAATAAACTAATTTATTAA
-30 5.5 TAAATAAACTAATTTATTAAATA
-21 5.2 TAATTTATTAAATATAATATTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Bacteroides coprophilus DSM 18228 BACCOPRO_02518 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855 BACDOR_00694 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides eggerthii DSM 20697 BACEGG_02294 -85 6 TTAATAAAATAATTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1712 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00275 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01905 -94 5.8 TATTTAATAAAATAAATTATTAA
Bacteroides vulgatus ATCC 8482 BVU_4117 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Position: -234
Score: 5.4
Sequence: TCATTAATAAATTATTATATTTA
Position: -132
Score: 4.7
Sequence: ACAATAAAACAAAGTATTAATTA
Position: -2
Score: 4.7
Sequence: TTATGAAAAAATTATTTTTGATT
Locus tag: BACPLE_00596
BACPLE_00596 -234 5.4 TCATTAATAAATTATTATATTTA
-132 4.7 ACAATAAAACAAAGTATTAATTA
-2 4.7 TTATGAAAAAATTATTTTTGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanM
Ortholog function: Sialic acid-induced transmembrane protein YjhT(NanM), possible mutarotase
Bacteroides dorei DSM 17855 BACDOR_00669 -47 4.8 ATTTCAATAAAAACTTTTATTTT
Bacteroides fragilis NCTC 9343 BF1812 -91 5.6 TATATAATAAAATATTTAATTAA
-88 6.1 ATAATAAAATATTTAATTAATAT
-27 5.1 ATATTAATAAATAATAGTATTGA
Bacteroides plebeius DSM 17135 BACPLE_00596 -234 5.4 TCATTAATAAATTATTATATTTA
Position: -88
Score: 5.4
Sequence: TAAATATAATAATTTATTAATGA
Locus tag: BACPLE_00597
BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanR
Ortholog function: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04950 -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides dorei DSM 17855 BACDOR_00695 -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697 BACEGG_02291 -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343 BF1711 -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483 BACOVA_01791 -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135 BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Bacteroides stercoris ATCC 43183 BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482 BT0433 -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492 BACUNI_02075 -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482 BVU_4116 -190 5.5 AAACTAAATTTATTTATTAATAA
Position: -122
Score: 4.9
Sequence: TAAAAAATCTATTTTTTTATTTG
Locus tag: BACPLE_01828
BACPLE_01828 -122 4.9 TAAAAAATCTATTTTTTTATTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagB
Ortholog function: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Bacteroides dorei DSM 17855 BACDOR_00691 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides plebeius DSM 17135 BACPLE_01828 -122 4.9 TAAAAAATCTATTTTTTTATTTG
Bacteroides vulgatus ATCC 8482 BVU_4120 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Position: -84
Score: 4.9
Sequence: CTGATAATAAATTTATATATTTA
Position: -81
Score: 5
Sequence: ATAATAAATTTATATATTTACAT
Locus tag: BACPLE_02962
BACPLE_02962 -84 4.9 CTGATAATAAATTTATATATTTA
-81 5 ATAATAAATTTATATATTTACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nahC
Ortholog function: Beta-hexosaminidase (EC 3.2.1.52)
Bacteroides dorei DSM 17855 BACDOR_00670 -47 4.8 ATTTCAATAAAAACTTTTATTTT
Bacteroides fragilis NCTC 9343 BF1813 -91 5.6 TATATAATAAAATATTTAATTAA
-88 6.1 ATAATAAAATATTTAATTAATAT
-27 5.1 ATATTAATAAATAATAGTATTGA
Bacteroides plebeius DSM 17135 BACPLE_02962 -81 5 ATAATAAATTTATATATTTACAT
Position: -43
Score: 4.8
Sequence: TTAACAAACTATTAATTAATTAA
Locus tag: BACPLE_03178
BACPLE_03178 -43 4.8 TTAACAAACTATTAATTAATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: exbB
Ortholog function: Outer membrane transport system, transport protein ExbB
Bacteroides cellulosilyticus DSM 14838 BACCELL_01010 -44 5.7 ATAATAAACAAATTAATTAATTA
Bacteroides coprophilus DSM 18228 BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Bacteroides eggerthii DSM 20697 BACEGG_00309 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides fragilis NCTC 9343 BF3530 -43 5.5 ATAATAATAATTTAATTAATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides stercoris ATCC 43183 BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides thetaiotaomicron VPI-5482 BT2055 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides uniformis ATCC 8492 BACUNI_01658 -44 5.9 ATAATAAATAAATTAATTAATTA