Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Crp regulog to Bacteroides plebeius DSM 17135

Reference regulog properties
Source regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides plebeius DSM 17135
Orthologous TF(s) BACPLE_02167
Regulated genes 4
Built upon 113 sites [see more]
Predicted regulatory interactions in Bacteroides plebeius DSM 17135
Locus tag Position Score Sequence
Position: -116
Score: 5.5
Sequence: TTTTATGTTATCCAACATATTC
Locus tag: BACPLE_00736
BACPLE_00736 -116 5.5 TTTTATGTTATCCAACATATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: BACCELL_00794
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838 BACCELL_00794 -135 6.1 TTTTATGTTATAAAACATATTT
Bacteroides dorei DSM 17855 BACDOR_04003 -33 4.5 TTTTAGGTTTAACAAATTAAAA
Bacteroides eggerthii DSM 20697 BACEGG_00156 -129 5.5 TTTTGTGTTATAAAACATATTC
Bacteroides fragilis NCTC 9343 BF3646 -151 6 TTTTATGTTGAATAACATATTT
Bacteroides ovatus ATCC 8483 BACOVA_03166 -135 5.8 TTTTATGCTATAAAACATATTC
Bacteroides plebeius DSM 17135 BACPLE_00736 -116 5.5 TTTTATGTTATCCAACATATTC
Bacteroides stercoris ATCC 43183 BACSTE_03638 -132 5.7 TTTTGTGTTATAAAACATAATC
Bacteroides thetaiotaomicron VPI-5482 BT2178 -135 5.4 TTTTATGCTATAAAACATATCG
Bacteroides uniformis ATCC 8492 BACUNI_03316 -125 5.7 TTTTGTGTTATAAAACATATAC
Bacteroides vulgatus ATCC 8482 BVU_2553 -33 4.5 TTTTAGGTTTAACAAATTAAAA
Position: -16
Score: 4.1
Sequence: CTTTGTGCTTAATAACATGGTT
Locus tag: BACPLE_02167
BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: transcriptional regulator, Crp/Fnr family
Bacteroides cellulosilyticus DSM 14838 BACCELL_03476 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855 BACDOR_01607 -35 4.1 ATTTGTGCTCTATAACACGGTT
Bacteroides eggerthii DSM 20697 BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides fragilis NCTC 9343 BF0954 -33 4.6 ATTTGTGCTTTATAACACAGTT
Bacteroides ovatus ATCC 8483 BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides plebeius DSM 17135 BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183 BACSTE_03515 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482 BT4338 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides uniformis ATCC 8492 BACUNI_04721 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides vulgatus ATCC 8482 BVU_3580 -35 4.1 ATTTGTGCTCTATAACACGGTT
Position: -93
Score: 4.6
Sequence: AAATCTGTTCTTAAACATAGCT
Locus tag: BACPLE_02898
BACPLE_02898 -93 4.6 AAATCTGTTCTTAAACATAGCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: fucR
Ortholog function: Transcriptional regulator of fucose utilization, GntR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04988 -124 5.2 TTATATGCTGCAAAACATATCC
Bacteroides dorei DSM 17855 BACDOR_02265 -114 5.1 TCTTGTGTTATAAAACATACCA
Bacteroides fragilis NCTC 9343 BF0210 -114 5.6 TTTGATGTTGTATAACATACCA
Bacteroides ovatus ATCC 8483 BACOVA_03849 -100 5.8 TTTTCTGCTATAAAACATATCA
Bacteroides plebeius DSM 17135 BACPLE_02898 -93 4.6 AAATCTGTTCTTAAACATAGCT
Bacteroides thetaiotaomicron VPI-5482 BT1272 -100 5.5 TTTCCTGCTATAGAACATATTA
Bacteroides vulgatus ATCC 8482 BVU_1374 -114 5 TCTTGTGTTATAAAACATACCT