Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of FucR regulog to Bacteroides plebeius DSM 17135

Reference regulog properties
Source regulog: FucR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Fucose utilization
Effector: Fucose
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides plebeius DSM 17135
Orthologous TF(s) BACPLE_02898
Regulated genes 1
Built upon 8 sites [see more]
Predicted regulatory interactions in Bacteroides plebeius DSM 17135
Locus tag Position Score Sequence
Position: -39
Score: 5.8
Sequence: CTTTGTGTCAGGATAGTTCAGCACAG
Locus tag: BACPLE_02898
BACPLE_02898 -39 5.8 CTTTGTGTCAGGATAGTTCAGCACAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: fucR
Ortholog function: Transcriptional regulator of fucose utilization, GntR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04988 -69 6.3 CTTTGCACCAGCACAGTTCAGCACAG
Bacteroides dorei DSM 17855 BACDOR_02265 -59 6.2 CTTTGCATCGGGACAGTTCAGCACAG
Bacteroides fragilis NCTC 9343 BF0210 -59 6 CTTTGTATCATGATAGTTCAGCATAG
Bacteroides ovatus ATCC 8483 BACOVA_03849 -45 6.6 CTTTGCATCAGCATAGTTCAGCATAG
Bacteroides plebeius DSM 17135 BACPLE_02898 -39 5.8 CTTTGTGTCAGGATAGTTCAGCACAG
Bacteroides thetaiotaomicron VPI-5482 BT1272 -45 6.4 CTTTGCAACAGCATAGCTCAGCACAG
Bacteroides vulgatus ATCC 8482 BVU_1374 -59 6.2 CTTTGCATCGGGACAGTTCAGCACAG