Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of SusR2 regulog to Bacteroides finegoldii DSM 17565

Reference regulog properties
Source regulog: SusR2 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Starch utilization
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides finegoldii DSM 17565
Orthologous TF(s) BACFIN_03703
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Bacteroides finegoldii DSM 17565
Locus tag Position Score Sequence
Position: -204
Score: 6.5
Sequence: AAAACCACTACTTTTTTAGT
Locus tag: BACFIN_03704
BACFIN_03704 -204 6.5 AAAACCACTACTTTTTTAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC2
Ortholog function: SusC2, outer membrane protein involved in starch binding
Bacteroides cellulosilyticus DSM 14838 BACCELL_04952 -208 5.7 ATTTTTACTACTTTTTTGGA
-131 6.2 AAAACTACTACTTTTTCACT
Bacteroides ovatus ATCC 8483 BACOVA_02787 -204 6.6 AAAATCACTACTTTTTTAGT
-127 5.9 TAAATCACTATATTTTTGCT
Bacteroides thetaiotaomicron VPI-5482 BT3090 -186 6.1 AAATCCACTACTTTTTTAGC
-109 5.9 TAAACCACTATATTTTTGCT
Bacteroides uniformis ATCC 8492 BACUNI_01942 -206 6.2 ATTTTCACTACTTTTTTAGT
-129 6.5 TAAACCACTACTTTTTTACT