Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of XylR regulog to Bacteroides finegoldii DSM 17565

Reference regulog properties
Source regulog: XylR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides finegoldii DSM 17565
Orthologous TF(s) BACFIN_04235
Regulated genes 2
Built upon 43 sites [see more]
Predicted regulatory interactions in Bacteroides finegoldii DSM 17565
Locus tag Position Score Sequence
Position: -127
Score: 5.9
Sequence: CTTATTGTATTATAAACAAGAAG
Locus tag: BACFIN_01707
BACFIN_01707 -127 5.9 CTTATTGTATTATAAACAAGAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: tkt
Ortholog function: Transketolase (EC 2.2.1.1)
Bacteroides cellulosilyticus DSM 14838 BACCELL_05612 -161 5.9 CTTATTGTATTTTAAACAAGAAG
Bacteroides eggerthii DSM 20697 BACEGG_01528 -166 5.6 CTTATTGTAATCAAAACAAGAAG
Bacteroides ovatus ATCC 8483 BACOVA_01706 -128 5.6 CTTATTGTATCACAAACAAGAAG
Bacteroides stercoris ATCC 43183 BACSTE_01846 -161 5.3 GTTATTGTATTCAAAACAGGAAG
Bacteroides thetaiotaomicron VPI-5482 BT0347 -162 5.3 CTTACTGTATTGTAAACAAGAAG
Position: -327
Score: 6.1
Sequence: CATATCGTTTAAAATACAATAAG
Position: -243
Score: 5.5
Sequence: GTTTTCGTACTTTATACAATTAC
Position: -197
Score: 5.5
Sequence: CATATTGTAAATTGTAAGATAAC
Position: -164
Score: 5.5
Sequence: CATATTGTATGGTATATGATATG
Locus tag: BACFIN_04235
BACFIN_04235 -327 6.1 CATATCGTTTAAAATACAATAAG
-243 5.5 GTTTTCGTACTTTATACAATTAC
-197 5.5 CATATTGTAAATTGTAAGATAAC
-164 5.5 CATATTGTATGGTATATGATATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylR
Ortholog function: Predicted regulator of xylose utilization, NrtR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04758 -200 5.6 CTTATTGTACTTCCTACAATTAC
-152 5.7 CATATTGTACTTTCAACGATAAG
-119 5.8 GATATTGTAAAATGTACGATATC
Bacteroides dorei DSM 17855 BACDOR_00865 -103 5.1 TATATTGTAGTGTATATGATAAG
-70 4.9 CATATTGTATAATAGATGATATT
Bacteroides eggerthii DSM 20697 BACEGG_02642 -208 5.1 GTTATTGTGCCTATTACAATTAC
-161 6.1 CATATTGTATTTTGTACGATAAC
-128 5.4 GATATTGTAAAAGATATGATATG
Bacteroides fragilis NCTC 9343 BF2354 -280 5.4 CATACCCTATAAAATACAATAAG
-197 5.1 CTTTCTGTACTTTCTACAATTAC
-150 5.7 CATATTGTTATCGATACAATAAG
-117 5.4 CTTAGTGTAAAATTTACGATATG
Bacteroides ovatus ATCC 8483 BACOVA_02532 -279 6.1 CATATCGTTTAAAATACAATAAG
-195 5.6 GTTTTTGTACTTTATACAATTAC
-149 5.4 CATATTGTAATTCGTAAGATAAC
-116 5.4 CATATTGTAGAATGTATGATATG
Bacteroides plebeius DSM 17135 BACPLE_02263 -147 5.8 CATATTGTATGAACTACAAAAAC
-114 5.2 GATATTGTATCAAATAAGATATT
Bacteroides stercoris ATCC 43183 BACSTE_01380 -208 5.5 GTTATTGTATCTGCTACAATTAC
-161 6.3 CATATTGTATTTTATACGATAAC
-128 5.8 GATATTGTAAGATATACGATATG
Bacteroides thetaiotaomicron VPI-5482 BT0791 -280 5.9 GATATCGTTTGAAATACAATAAG
-196 5.7 CTTTTTGTACTTTATACAATTAC
-150 5.1 CATATTGTAATTCAGAAGATAAC
-117 5.4 CATATTGTAGATTGTATGATATG
Bacteroides uniformis ATCC 8492 BACUNI_00695 -209 5.7 CTTATTGTACTTCCTACAATTAG
-161 5.9 CATATTGTATTCCATACGATAAC
-128 5.7 GATATTGTATAAAGTAAGATATG
Bacteroides vulgatus ATCC 8482 BVU_3955 -169 5.1 TATATTGTAGTGTATATGATAAG
-136 4.5 GATATTGTATGATGGATGATATT