Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of HTCS_Ara-1 regulog to Bacteroides eggerthii DSM 20697

Reference regulog properties
Source regulog: HTCS_Ara-1 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides eggerthii DSM 20697
Orthologous TF(s) BACEGG_01541
Regulated genes 2
Built upon 12 sites [see more]
Predicted regulatory interactions in Bacteroides eggerthii DSM 20697
Locus tag Position Score Sequence
Position: -328
Score: 7.3
Sequence: TATCCACCTCTAAAACCCATTTGTCCACCC
Locus tag: BACEGG_01540
BACEGG_01540 -328 7.3 TATCCACCTCTAAAACCCATTTGTCCACCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Ara-3
Ortholog function: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Bacteroides dorei DSM 17855 BACDOR_01719 -291 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC
Bacteroides eggerthii DSM 20697 BACEGG_01540 -349 6.4 TCTCTACACTTAAAATTCGTTTATCCACCT
-328 7.3 TATCCACCTCTAAAACCCATTTGTCCACCC
Bacteroides plebeius DSM 17135 BACPLE_00643 -224 7.8 TATCCACCTATAAAATTCGTTTGTCCACCT
Bacteroides vulgatus ATCC 8482 BVU_1005 -265 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC
Position: -285
Score: 7.4
Sequence: TGTCCACCTTAAAAGGTCATATATCCACCT
Locus tag: BACEGG_01542
BACEGG_01542 -285 7.4 TGTCCACCTTAAAAGGTCATATATCCACCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: abn2
Ortholog function: Arabinan endo-1,5-alpha-L-arabinosidase
Bacteroides cellulosilyticus DSM 14838 BACCELL_05304 -268 7.8 TGTCCACCTCAAATGTTCATTTGTCCACCT
Bacteroides dorei DSM 17855 BACDOR_01716 -159 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT
Bacteroides eggerthii DSM 20697 BACEGG_01542 -285 7.4 TGTCCACCTTAAAAGGTCATATATCCACCT
Bacteroides thetaiotaomicron VPI-5482 BT0367 -69 7 TGTCCACCAATCGTGTTCGTATGTCCACCT
Bacteroides vulgatus ATCC 8482 BVU_1002 -169 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT