Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides eggerthii DSM 20697

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides eggerthii DSM 20697
Orthologous TF(s) BACEGG_02291
Regulated genes 4
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides eggerthii DSM 20697
Locus tag Position Score Sequence
Position: -60
Score: 4.8
Sequence: AAAACAATAAATAAATATAATAA
Position: -53
Score: 4.7
Sequence: TAAATAAATATAATAAGTAATTT
Position: -47
Score: 4.7
Sequence: AATATAATAAGTAATTTAATTAA
Position: -44
Score: 5.5
Sequence: ATAATAAGTAATTTAATTAATTA
Position: -40
Score: 4.9
Sequence: TAAGTAATTTAATTAATTAATCT
Locus tag: BACEGG_00309
BACEGG_00309 -60 4.8 AAAACAATAAATAAATATAATAA
-53 4.7 TAAATAAATATAATAAGTAATTT
-47 4.7 AATATAATAAGTAATTTAATTAA
-44 5.5 ATAATAAGTAATTTAATTAATTA
-40 4.9 TAAGTAATTTAATTAATTAATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: exbB
Ortholog function: Outer membrane transport system, transport protein ExbB
Bacteroides cellulosilyticus DSM 14838 BACCELL_01010 -44 5.7 ATAATAAACAAATTAATTAATTA
Bacteroides coprophilus DSM 18228 BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Bacteroides eggerthii DSM 20697 BACEGG_00309 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides fragilis NCTC 9343 BF3530 -43 5.5 ATAATAATAATTTAATTAATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides stercoris ATCC 43183 BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides thetaiotaomicron VPI-5482 BT2055 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides uniformis ATCC 8492 BACUNI_01658 -44 5.9 ATAATAAATAAATTAATTAATTA
Position: -89
Score: 4.9
Sequence: AAATATATTAAATAATTTATTAT
Position: -86
Score: 5.1
Sequence: TATATTAAATAATTTATTATCTA
Position: -59
Score: 5
Sequence: ATAATTAATAAATTATTTTATTA
Position: -58
Score: 6.2
Sequence: TAATTAATAAATTATTTTATTAT
Position: -55
Score: 5.5
Sequence: TTAATAAATTATTTTATTATAGT
Position: -50
Score: 5
Sequence: AAATTATTTTATTATAGTAATAA
Locus tag: BACEGG_02291
BACEGG_02291 -89 4.9 AAATATATTAAATAATTTATTAT
-86 5.1 TATATTAAATAATTTATTATCTA
-59 5 ATAATTAATAAATTATTTTATTA
-58 6.2 TAATTAATAAATTATTTTATTAT
-55 5.5 TTAATAAATTATTTTATTATAGT
-50 5 AAATTATTTTATTATAGTAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanR
Ortholog function: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04950 -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides dorei DSM 17855 BACDOR_00695 -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697 BACEGG_02291 -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343 BF1711 -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483 BACOVA_01791 -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135 BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Bacteroides stercoris ATCC 43183 BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482 BT0433 -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492 BACUNI_02075 -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482 BVU_4116 -190 5.5 AAACTAAATTTATTTATTAATAA
Position: -102
Score: 5
Sequence: TTATTACTATAATAAAATAATTT
Position: -97
Score: 5.5
Sequence: ACTATAATAAAATAATTTATTAA
Position: -94
Score: 6.2
Sequence: ATAATAAAATAATTTATTAATTA
Position: -93
Score: 5
Sequence: TAATAAAATAATTTATTAATTAT
Position: -66
Score: 5.1
Sequence: TAGATAATAAATTATTTAATATA
Position: -63
Score: 4.9
Sequence: ATAATAAATTATTTAATATATTT
Locus tag: BACEGG_02292
BACEGG_02292 -102 5 TTATTACTATAATAAAATAATTT
-97 5.5 ACTATAATAAAATAATTTATTAA
-94 6.2 ATAATAAAATAATTTATTAATTA
-93 5 TAATAAAATAATTTATTAATTAT
-66 5.1 TAGATAATAAATTATTTAATATA
-63 4.9 ATAATAAATTATTTAATATATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF04074
Ortholog function: Conserved hypothetical protein, PF04074 family
Bacteroides coprophilus DSM 18228 BACCOPRO_02521 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides eggerthii DSM 20697 BACEGG_02292 -94 6.2 ATAATAAAATAATTTATTAATTA
Bacteroides fragilis NCTC 9343 BF1715 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00273 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01903 -92 6 ATAATAAAATAATTTATTATATA
Position: -88
Score: 5.8
Sequence: TATTTAATAAAATAATTTATTAA
Position: -85
Score: 6
Sequence: TTAATAAAATAATTTATTAAATA
Position: -84
Score: 5
Sequence: TAATAAAATAATTTATTAAATAT
Locus tag: BACEGG_02293
BACEGG_02293 -88 5.8 TATTTAATAAAATAATTTATTAA
-85 6 TTAATAAAATAATTTATTAAATA
-84 5 TAATAAAATAATTTATTAAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanT-II
Ortholog function: Predicted N-acetyl-neuraminate transporter, MFS family
Bacteroides coprophilus DSM 18228 BACCOPRO_02520 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855 BACDOR_00692 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides eggerthii DSM 20697 BACEGG_02293 -85 6 TTAATAAAATAATTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1714 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00272 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01904 -94 5.8 TATTTAATAAAATAAATTATTAA
Bacteroides vulgatus ATCC 8482 BVU_4119 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT