Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of ManR regulog to Bacteroides eggerthii DSM 20697

Reference regulog properties
Source regulog: ManR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Mannose utilization; Mannosides utilization
Effector: Mannose
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides eggerthii DSM 20697
Orthologous TF(s) BACEGG_01984
Regulated genes 3
Built upon 9 sites [see more]
Predicted regulatory interactions in Bacteroides eggerthii DSM 20697
Locus tag Position Score Sequence
Position: -119
Score: 5.4
Sequence: TACTTTGTTTGAACATATAT
Locus tag: BACEGG_01984
BACEGG_01984 -119 5.4 TACTTTGTTTGAACATATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: manR
Ortholog function: Predicted transcriptional regulator of Mannose utilization, GntR family
Bacteroides eggerthii DSM 20697 BACEGG_01984 -119 5.4 TACTTTGTTTGAACATATAT
Bacteroides ovatus ATCC 8483 BACOVA_03251 22 5.9 TTATATGTTCATACATACTT
Bacteroides thetaiotaomicron VPI-5482 BT2103 -108 5.8 TAGTATGTCTGAACATATAA
Position: -29
Score: 5.4
Sequence: ATATATGTTCAAACAAAGTA
Locus tag: BACEGG_01985
BACEGG_01985 -29 5.4 ATATATGTTCAAACAAAGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pmi
Ortholog function: Mannose-6-phosphate isomerase (EC 5.3.1.8)
Bacteroides eggerthii DSM 20697 BACEGG_01985 -29 5.4 ATATATGTTCAAACAAAGTA
Bacteroides ovatus ATCC 8483 BACOVA_03250 -4 5.9 AAGTATGTATGAACATATAA
Bacteroides thetaiotaomicron VPI-5482 BT2104 -41 5.8 TTATATGTTCAGACATACTA
Position: -4
Score: 5.6
Sequence: TATTATGTATGAACATGATA
Locus tag: BACEGG_01986
BACEGG_01986 -4 5.6 TATTATGTATGAACATGATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manK
Ortholog function: predicted mannose kinase, ROK family
Bacteroides eggerthii DSM 20697 BACEGG_01986 -4 5.6 TATTATGTATGAACATGATA
Bacteroides ovatus ATCC 8483 BACOVA_03252 -4 5.1 AACTATGTATGAACATGATG