Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Crp regulog to Bacteroides eggerthii DSM 20697

Reference regulog properties
Source regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides eggerthii DSM 20697
Orthologous TF(s) BACEGG_01340
Regulated genes 9
Built upon 113 sites [see more]
Predicted regulatory interactions in Bacteroides eggerthii DSM 20697
Locus tag Position Score Sequence
Position: -129
Score: 5.5
Sequence: TTTTGTGTTATAAAACATATTC
Locus tag: BACEGG_00156
BACEGG_00156 -129 5.5 TTTTGTGTTATAAAACATATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: BACCELL_00794
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838 BACCELL_00794 -135 6.1 TTTTATGTTATAAAACATATTT
Bacteroides dorei DSM 17855 BACDOR_04003 -33 4.5 TTTTAGGTTTAACAAATTAAAA
Bacteroides eggerthii DSM 20697 BACEGG_00156 -129 5.5 TTTTGTGTTATAAAACATATTC
Bacteroides fragilis NCTC 9343 BF3646 -151 6 TTTTATGTTGAATAACATATTT
Bacteroides ovatus ATCC 8483 BACOVA_03166 -135 5.8 TTTTATGCTATAAAACATATTC
Bacteroides plebeius DSM 17135 BACPLE_00736 -116 5.5 TTTTATGTTATCCAACATATTC
Bacteroides stercoris ATCC 43183 BACSTE_03638 -132 5.7 TTTTGTGTTATAAAACATAATC
Bacteroides thetaiotaomicron VPI-5482 BT2178 -135 5.4 TTTTATGCTATAAAACATATCG
Bacteroides uniformis ATCC 8492 BACUNI_03316 -125 5.7 TTTTGTGTTATAAAACATATAC
Bacteroides vulgatus ATCC 8482 BVU_2553 -33 4.5 TTTTAGGTTTAACAAATTAAAA
Position: -193
Score: 5.8
Sequence: GACTATGTTATATAACATAAAA
Locus tag: BACEGG_01333
BACEGG_01333 -193 5.8 GACTATGTTATATAACATAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nupG
Ortholog function: Nucleoside permease NupG
Bacteroides eggerthii DSM 20697 BACEGG_01333 -193 5.8 GACTATGTTATATAACATAAAA
Bacteroides ovatus ATCC 8483 BACOVA_05132 -269 5.6 CATTATGTTGTATAACATAAAC
Bacteroides thetaiotaomicron VPI-5482 BT4330 -271 5.7 CATTATGTTCTATAACATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_01546 -245 5 CAGCATGTTATATAACATAAAC
Position: -33
Score: 4.6
Sequence: ATTTGTGCTGTACAACACAGTT
Locus tag: BACEGG_01340
BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: transcriptional regulator, Crp/Fnr family
Bacteroides cellulosilyticus DSM 14838 BACCELL_03476 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855 BACDOR_01607 -35 4.1 ATTTGTGCTCTATAACACGGTT
Bacteroides eggerthii DSM 20697 BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides fragilis NCTC 9343 BF0954 -33 4.6 ATTTGTGCTTTATAACACAGTT
Bacteroides ovatus ATCC 8483 BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides plebeius DSM 17135 BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183 BACSTE_03515 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482 BT4338 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides uniformis ATCC 8492 BACUNI_04721 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides vulgatus ATCC 8482 BVU_3580 -35 4.1 ATTTGTGCTCTATAACACGGTT
Position: -110
Score: 4.8
Sequence: TTTTCTTTTATGTTACATAACA
Position: -105
Score: 6.1
Sequence: TTTTATGTTACATAACATACAA
Locus tag: BACEGG_01536
BACEGG_01536 -110 4.8 TTTTCTTTTATGTTACATAACA
-105 6.1 TTTTATGTTACATAACATACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: araM
Ortholog function: Aldose 1-epimerase (EC 5.1.3.3), L-arabinose mutarotase
Bacteroides cellulosilyticus DSM 14838 BACCELL_05604 -105 6 TTTTATGTTACATAACATATAC
Bacteroides dorei DSM 17855 BACDOR_03634 -104 5.6 TTTTATGTTGCACAACATACTC
Bacteroides eggerthii DSM 20697 BACEGG_01536 -105 6.1 TTTTATGTTACATAACATACAA
Bacteroides ovatus ATCC 8483 BACOVA_01715 -105 5.9 ATTTATGCTGCACAACATATAA
Bacteroides plebeius DSM 17135 BACPLE_02214 -89 4.9 TTCTATGTTGAAAAACATCTGA
Bacteroides thetaiotaomicron VPI-5482 BT0356 -105 6.2 TTTTATGTTGCACAACATATAA
Bacteroides uniformis ATCC 8492 BACUNI_01357 -48 5.7 ACTTATGTTGCATAACATATAA
Bacteroides vulgatus ATCC 8482 BVU_2324 -104 5.6 TTTTATGTTGCACAACATACTC
Position: -4
Score: 6.1
Sequence: TTTTATGTTCTTCAGCATAAAA
Locus tag: BACEGG_01611
BACEGG_01611 -4 6.1 TTTTATGTTCTTCAGCATAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pflB
Ortholog function: Pyruvate formate-lyase (EC 2.3.1.54)
Bacteroides cellulosilyticus DSM 14838 BACCELL_03929 -107 6 TTTTATGTCGTACAACATAAAA
Bacteroides eggerthii DSM 20697 BACEGG_01611 -4 6.1 TTTTATGTTCTTCAGCATAAAA
Bacteroides fragilis NCTC 9343 BF1323 -107 6.3 TTTTATGCTATTCAACATAAAA
Bacteroides ovatus ATCC 8483 BACOVA_05597 -113 6.1 TTTTATGTTGAAAAGCATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_00806 -116 6.1 TTTTATGCTCTTCAACATAAAA
Bacteroides thetaiotaomicron VPI-5482 BT4738 -114 6.1 TTTTATGTTGAAAAGCATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_04526 -117 6.2 TTTTATGCTGTTCAACATAAAA
Position: -109
Score: 5.6
Sequence: TAACGTGTTATATAACATAAAA
Locus tag: BACEGG_02494
BACEGG_02494 -109 5.6 TAACGTGTTATATAACATAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF09719
Ortholog function: Putative redox-active protein (C_GCAxxG_C_C)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04404 -142 5.6 TTTTATGACATATAACATAAAA
-110 5.8 TAATGTGTTATATAACATAAAT
Bacteroides dorei DSM 17855 BACDOR_00927 -110 4.6 AAAAGTGTTGAATAACATAATT
Bacteroides eggerthii DSM 20697 BACEGG_02494 -109 5.6 TAACGTGTTATATAACATAAAA
Bacteroides fragilis NCTC 9343 BF2582 -99 5.9 TAATCTGTTATATAACATAATT
Bacteroides ovatus ATCC 8483 BACOVA_02257 -107 5.3 TAAAGTGTTATATAACATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_01186 -110 5.4 TAACGTGCTATATAACATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_02281 -105 5.3 TAACGTGTTGTATAACATAAAT
Bacteroides vulgatus ATCC 8482 BVU_3908 -104 4.6 AAAAGTGTTGAATAACATAATT
Position: -25
Score: 4.2
Sequence: TTTGCAGCCGTTAAACATAAAT
Locus tag: BACEGG_02642
BACEGG_02642 -25 4.2 TTTGCAGCCGTTAAACATAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylR
Ortholog function: Predicted regulator of xylose utilization, NrtR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04758 -83 4.9 AATAGTGCTTTATAACATAATA
Bacteroides dorei DSM 17855 BACDOR_00865 -34 4.8 AATAGTGTTTTAGAACATAATA
Bacteroides eggerthii DSM 20697 BACEGG_02642 -92 4.8 AATAATGCTTTGTAACATATCA
Bacteroides fragilis NCTC 9343 BF2354 -81 4.6 AACAATGCTTTATAGCATATTA
Bacteroides ovatus ATCC 8483 BACOVA_02532 -80 4.2 AACAATGTTTTATAGCATGTTT
Bacteroides stercoris ATCC 43183 BACSTE_01380 -92 4.3 AATAATGCTTTATAACATTGTA
Bacteroides thetaiotaomicron VPI-5482 BT0791 -81 4.2 AACAATGTTTTATAGCATGTCA
Bacteroides uniformis ATCC 8492 BACUNI_00695 -92 4.1 AATAATGCTTTATAATATTATA
Bacteroides vulgatus ATCC 8482 BVU_3955 -100 4.5 AATAGTGTTTTGGAACATAATA
Position: -74
Score: 6.3
Sequence: TTTTATGTTATTTAGCATAAAA
Locus tag: BACEGG_02676
BACEGG_02676 -74 6.3 TTTTATGTTATTTAGCATAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: serB
Ortholog function: Phosphoserine phosphatase (EC 3.1.3.3)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04825 -163 5.5 TTTCATGTTATATAACATGTTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01694 -134 5.6 AATTATGCTTTTAAACATAAAT
Bacteroides dorei DSM 17855 BACDOR_02848 -116 6.1 AAATATGTTATATAGCATAAAA
Bacteroides eggerthii DSM 20697 BACEGG_02676 -74 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides fragilis NCTC 9343 BF2389 -71 6.2 TTTTATGTTATTTAGCATAAAT
Bacteroides ovatus ATCC 8483 BACOVA_02567 -66 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_01424 -74 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides thetaiotaomicron VPI-5482 BT0832 -67 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_00649 -75 6.2 TTTTATGTTATTTAGCATAAAT
Bacteroides vulgatus ATCC 8482 BVU_3158 -116 6.1 AAATATGTTATATAGCATAAAA
Position: -188
Score: 5.3
Sequence: TAATATGTTACACAAAAGAAAA
Position: -61
Score: 5.8
Sequence: TTTTCTGTTATAGAACAGAATT
Locus tag: BACEGG_03101
BACEGG_03101 -188 5.3 TAATATGTTACACAAAAGAAAA
-61 5.8 TTTTCTGTTATAGAACAGAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF01694
Ortholog function: Peptidase S54, rhomboid domain
Bacteroides cellulosilyticus DSM 14838 BACCELL_02471 -196 5 TAATATGTTACACAAAAGATAT
-62 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides dorei DSM 17855 BACDOR_01705 -71 6.2 TTTTCTGTTATATAACAGAATA
Bacteroides eggerthii DSM 20697 BACEGG_03101 -188 5.3 TAATATGTTACACAAAAGAAAA
-61 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides fragilis NCTC 9343 BF4221 -227 5 ATATATGTTACACAAAAGATAT
-105 5.7 TTTTCTGTTGTAGAACAGAATT
Bacteroides ovatus ATCC 8483 BACOVA_02079 -195 5 ATATATGTTACACAAAAGATTA
-66 5.4 TTTCATGCTTTAAAACAGAATT
Bacteroides stercoris ATCC 43183 BACSTE_02140 -188 4.3 TTAATTGTTACACAAAAGAAAA
-61 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides thetaiotaomicron VPI-5482 BT2831 -192 4.9 ATATATGTTACACAAAAGATTT
-69 5 TTCCATGCTTTAAAACAGAATT
Bacteroides uniformis ATCC 8492 BACUNI_03999 -230 5 TAATATGTTACACAAAAGATAT
-97 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides vulgatus ATCC 8482 BVU_0995 -71 6.2 TTTTCTGTTATATAACAGAATA