Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides dorei DSM 17855

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides dorei DSM 17855
Orthologous TF(s) BACDOR_00695
Regulated genes 4
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides dorei DSM 17855
Locus tag Position Score Sequence
Position: -47
Score: 4.8
Sequence: ATTTCAATAAAAACTTTTATTTT
Locus tag: BACDOR_00663
BACDOR_00663 -47 4.8 ATTTCAATAAAAACTTTTATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanH
Ortholog function: Sialidase (EC 3.2.1.18)
Bacteroides dorei DSM 17855 BACDOR_00663 -47 4.8 ATTTCAATAAAAACTTTTATTTT
Bacteroides vulgatus ATCC 8482 BVU_4143 -47 4.8 ATTTCAATAAAAACTTTTATTTT
Position: -111
Score: 5.5
Sequence: TTATTAATAAATAAATTTAGTTT
Position: -108
Score: 5.2
Sequence: TTAATAAATAAATTTAGTTTTTA
Position: -40
Score: 4.8
Sequence: TAAGTAATATAAAATATTCATTT
Locus tag: BACDOR_00694
BACDOR_00694 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Bacteroides coprophilus DSM 18228 BACCOPRO_02518 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855 BACDOR_00694 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides eggerthii DSM 20697 BACEGG_02294 -85 6 TTAATAAAATAATTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1712 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00275 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01905 -94 5.8 TATTTAATAAAATAAATTATTAA
Bacteroides vulgatus ATCC 8482 BVU_4117 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Position: -288
Score: 4.8
Sequence: AAATGAATATTTTATATTACTTA
Position: -220
Score: 5.2
Sequence: TAAAAACTAAATTTATTTATTAA
Position: -217
Score: 5.5
Sequence: AAACTAAATTTATTTATTAATAA
Locus tag: BACDOR_00695
BACDOR_00695 -288 4.8 AAATGAATATTTTATATTACTTA
-220 5.2 TAAAAACTAAATTTATTTATTAA
-217 5.5 AAACTAAATTTATTTATTAATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanR
Ortholog function: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04950 -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides dorei DSM 17855 BACDOR_00695 -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697 BACEGG_02291 -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343 BF1711 -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483 BACOVA_01791 -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135 BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Bacteroides stercoris ATCC 43183 BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482 BT0433 -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492 BACUNI_02075 -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482 BVU_4116 -190 5.5 AAACTAAATTTATTTATTAATAA
Position: -160
Score: 5
Sequence: ATAATAAAATATTTTTGTTTATA
Locus tag: BACDOR_01206
BACDOR_01206 -160 5 ATAATAAAATATTTTTGTTTATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Nan-5
Ortholog function: TonB-dependent outer membrane transporter of sialic acid oligomers
Bacteroides dorei DSM 17855 BACDOR_01206 -163 4.8 GTTATAATAAAATATTTTTGTTT
-160 5 ATAATAAAATATTTTTGTTTATA
Bacteroides fragilis NCTC 9343 BF1719 -39 5.3 ATTATAATTTTCTTTATTATTAA
Bacteroides plebeius DSM 17135 BACPLE_00590 -267 5.2 TATATAAATAATATTTTTATCAT
-156 5 TTCATAAAATATTTTATCAAATA
Bacteroides vulgatus ATCC 8482 BVU_2432 -92 6.1 TTTTTAATAAATTATTTTATTAA