Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of XylR regulog to Bacteroides dorei DSM 17855

Reference regulog properties
Source regulog: XylR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides dorei DSM 17855
Orthologous TF(s) BACDOR_00865
Regulated genes 2
Built upon 43 sites [see more]
Predicted regulatory interactions in Bacteroides dorei DSM 17855
Locus tag Position Score Sequence
Position: -41
Score: 5.9
Sequence: GTTATTGTATTTATTACGAAAAC
Locus tag: BACDOR_00759
BACDOR_00759 -41 5.9 GTTATTGTATTTATTACGAAAAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylE
Ortholog function: D-xylose proton-symporter XylE
Bacteroides cellulosilyticus DSM 14838 BACCELL_04761 -200 5.6 CTTATTGTACTTCCTACAATTAC
-152 5.7 CATATTGTACTTTCAACGATAAG
-119 5.8 GATATTGTAAAATGTACGATATC
Bacteroides dorei DSM 17855 BACDOR_00759 -41 5.9 GTTATTGTATTTATTACGAAAAC
Bacteroides eggerthii DSM 20697 BACEGG_02645 -208 5.1 GTTATTGTGCCTATTACAATTAC
-161 6.1 CATATTGTATTTTGTACGATAAC
-128 5.4 GATATTGTAAAAGATATGATATG
Bacteroides fragilis NCTC 9343 BF2357 -280 5.4 CATACCCTATAAAATACAATAAG
-197 5.1 CTTTCTGTACTTTCTACAATTAC
-150 5.7 CATATTGTTATCGATACAATAAG
-117 5.4 CTTAGTGTAAAATTTACGATATG
Bacteroides ovatus ATCC 8483 BACOVA_02535 -279 6.1 CATATCGTTTAAAATACAATAAG
-195 5.6 GTTTTTGTACTTTATACAATTAC
-149 5.4 CATATTGTAATTCGTAAGATAAC
-116 5.4 CATATTGTAGAATGTATGATATG
Bacteroides plebeius DSM 17135 BACPLE_02266 -147 5.8 CATATTGTATGAACTACAAAAAC
-114 5.2 GATATTGTATCAAATAAGATATT
Bacteroides thetaiotaomicron VPI-5482 BT0794 -280 5.9 GATATCGTTTGAAATACAATAAG
-196 5.7 CTTTTTGTACTTTATACAATTAC
-150 5.1 CATATTGTAATTCAGAAGATAAC
-117 5.4 CATATTGTAGATTGTATGATATG
Bacteroides uniformis ATCC 8492 BACUNI_00692 -209 5.7 CTTATTGTACTTCCTACAATTAG
-161 5.9 CATATTGTATTCCATACGATAAC
-128 5.7 GATATTGTATAAAGTAAGATATG
Bacteroides vulgatus ATCC 8482 BVU_4073 -41 5.9 GTTATTGTATTTATTACGAAAAC
Position: -110
Score: 5.6
Sequence: CTTTTCGTACAAAAAACAATATC
Locus tag: BACDOR_01992
BACDOR_01992 -110 5.6 CTTTTCGTACAAAAAACAATATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: GH3_Xyl
Ortholog function: Glycoside hydrolase family 3, candidate beta-glycosidase
Bacteroides dorei DSM 17855 BACDOR_01992 -110 5.6 CTTTTCGTACAAAAAACAATATC
Bacteroides vulgatus ATCC 8482 BVU_1162 -110 5.9 CTTTTTGTATAAAAAACAATATC