Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of SusR2 regulog to Bacteroides stercoris ATCC 43183

Reference regulog properties
Source regulog: SusR2 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Starch utilization
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides stercoris ATCC 43183
Orthologous TF(s) BACSTE_01927
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Bacteroides stercoris ATCC 43183
Locus tag Position Score Sequence
Position: -273
Score: 6.3
Sequence: TAAATCACTACTTTTTCACT
Locus tag: BACSTE_01926
BACSTE_01926 -273 6.3 TAAATCACTACTTTTTCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC2
Ortholog function: SusC2, outer membrane protein involved in starch binding
Bacteroides stercoris ATCC 43183 BACSTE_01926 -350 6.1 ATTTTTACTACTTTTTTAGT
-273 6.3 TAAATCACTACTTTTTCACT