Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of PerR regulog to Bacteroides stercoris ATCC 43183

Reference regulog properties
Source regulog: PerR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides stercoris ATCC 43183
Orthologous TF(s) BACSTE_01825
Regulated genes 4
Built upon 51 sites [see more]
Predicted regulatory interactions in Bacteroides stercoris ATCC 43183
Locus tag Position Score Sequence
Position: -39
Score: 6.3
Sequence: ATATTTGTAATCATTTCAATTTA
Locus tag: BACSTE_00720
BACSTE_00720 -39 6.3 ATATTTGTAATCATTTCAATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ftn
Ortholog function: Ferritin
Bacteroides cellulosilyticus DSM 14838 BACCELL_00354 -40 5.8 ACTTTTGTAATGATTTCAAATTA
Bacteroides eggerthii DSM 20697 BACEGG_01676 -39 6.3 ATATTTGTAATCATTTCAATTTA
Bacteroides stercoris ATCC 43183 BACSTE_00720 -39 6.3 ATATTTGTAATCATTTCAATTTA
Bacteroides uniformis ATCC 8492 BACUNI_04391 -36 5.8 ACTTTTGTAATGATTTCAATTTA
Position: -29
Score: 6.2
Sequence: ATATTTGTAATGATTATAATTTG
Locus tag: BACSTE_00833
BACSTE_00833 -29 6.2 ATATTTGTAATGATTATAATTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: BT1211
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838 BACCELL_04244 -29 6.5 ATATTTGTAATGATTATAAATTT
Bacteroides dorei DSM 17855 BACDOR_04415 -34 5.9 TTCTTTGTAATTATTACAACTTT
Bacteroides eggerthii DSM 20697 BACEGG_02389 -30 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides ovatus ATCC 8483 BACOVA_03967 -35 6.2 ATATTTGTACTCATTACAAATTA
Bacteroides plebeius DSM 17135 BACPLE_02813 -28 5.5 TACTTTGTAATCATTATAAAAAT
Bacteroides stercoris ATCC 43183 BACSTE_00833 -29 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides thetaiotaomicron VPI-5482 BT1211 -35 6.2 ATATTTGTACTCATTACAAATTC
Bacteroides uniformis ATCC 8492 BACUNI_02171 70 6.5 ATATTTGTAATCATTATAATTTT
Bacteroides coprophilus DSM 18228 BACCOPRO_00522 -28 5.2 TCCTTTGTAATTATTATAAAAAT
Position: -37
Score: 6.6
Sequence: AAAAATGTAATTATTACAAGTTT
Locus tag: BACSTE_01825
BACSTE_01825 -37 6.6 AAAAATGTAATTATTACAAGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: perR
Ortholog function: Peroxide stress regulator PerR, Fur family
Bacteroides cellulosilyticus DSM 14838 BACCELL_05678 -36 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides dorei DSM 17855 BACDOR_03683 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides eggerthii DSM 20697 BACEGG_01512 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides fragilis NCTC 9343 BF3019 -39 6.8 AAAATTGTAATGAATACAATTTT
Bacteroides plebeius DSM 17135 BACPLE_02660 -33 5.9 AGAATTGTAACAATTACATAATT
Bacteroides stercoris ATCC 43183 BACSTE_01825 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides uniformis ATCC 8492 BACUNI_01378 -38 6.6 AAAAATGTAATAATTACAAGTTT
Bacteroides vulgatus ATCC 8482 BVU_2366 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides coprophilus DSM 18228 BACCOPRO_01403 -33 6.1 AAAATTGTAATAGTTACAGAATT
Position: -45
Score: 6.1
Sequence: TAATTTGTAATATTTACAATATT
Locus tag: BACSTE_03162
BACSTE_03162 -45 6.1 TAATTTGTAATATTTACAATATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acn
Ortholog function: Aconitate hydratase (EC 4.2.1.3)
Bacteroides cellulosilyticus DSM 14838 BACCELL_00993 -47 6.1 TAATTTGTAATCTTTACAATATT
Bacteroides dorei DSM 17855 BACDOR_03102 -25 5.9 AAAACTGTAATAATTATAAATTG
Bacteroides eggerthii DSM 20697 BACEGG_00294 -48 6.1 TAATTTGTAATCTTTACAATATT
Bacteroides stercoris ATCC 43183 BACSTE_03162 -45 6.1 TAATTTGTAATATTTACAATATT
Bacteroides uniformis ATCC 8492 BACUNI_01674 -45 6 TAATTTGTAATCTTTACAATAAT
Bacteroides vulgatus ATCC 8482 BVU_1959 -19 5.6 AAAACTGTAATAATTATAAATGG