Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides stercoris ATCC 43183

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides stercoris ATCC 43183
Orthologous TF(s) BACSTE_01902
Regulated genes 5
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides stercoris ATCC 43183
Locus tag Position Score Sequence
Position: -242
Score: 6
Sequence: TATATAATAAATTATTTTATTAT
Position: -239
Score: 5.8
Sequence: ATAATAAATTATTTTATTATATA
Position: -215
Score: 4.7
Sequence: AAAATATAAAACTAAATTTATTA
Locus tag: BACSTE_01902
BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
-239 5.8 ATAATAAATTATTTTATTATATA
-215 4.7 AAAATATAAAACTAAATTTATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanR
Ortholog function: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04950 -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides dorei DSM 17855 BACDOR_00695 -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697 BACEGG_02291 -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343 BF1711 -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483 BACOVA_01791 -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135 BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Bacteroides stercoris ATCC 43183 BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482 BT0433 -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492 BACUNI_02075 -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482 BVU_4116 -190 5.5 AAACTAAATTTATTTATTAATAA
Position: -95
Score: 5.8
Sequence: TATATAATAAAATAATTTATTAT
Position: -92
Score: 6
Sequence: ATAATAAAATAATTTATTATATA
Locus tag: BACSTE_01903
BACSTE_01903 -95 5.8 TATATAATAAAATAATTTATTAT
-92 6 ATAATAAAATAATTTATTATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF04074
Ortholog function: Conserved hypothetical protein, PF04074 family
Bacteroides coprophilus DSM 18228 BACCOPRO_02521 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides eggerthii DSM 20697 BACEGG_02292 -94 6.2 ATAATAAAATAATTTATTAATTA
Bacteroides fragilis NCTC 9343 BF1715 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00273 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01903 -92 6 ATAATAAAATAATTTATTATATA
Position: -94
Score: 5.8
Sequence: TATTTAATAAAATAAATTATTAA
Position: -91
Score: 5.7
Sequence: TTAATAAAATAAATTATTAAATA
Position: -90
Score: 5
Sequence: TAATAAAATAAATTATTAAATAT
Locus tag: BACSTE_01904
BACSTE_01904 -94 5.8 TATTTAATAAAATAAATTATTAA
-91 5.7 TTAATAAAATAAATTATTAAATA
-90 5 TAATAAAATAAATTATTAAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanT-II
Ortholog function: Predicted N-acetyl-neuraminate transporter, MFS family
Bacteroides coprophilus DSM 18228 BACCOPRO_02520 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855 BACDOR_00692 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides eggerthii DSM 20697 BACEGG_02293 -85 6 TTAATAAAATAATTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1714 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00272 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01904 -94 5.8 TATTTAATAAAATAAATTATTAA
Bacteroides vulgatus ATCC 8482 BVU_4119 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT
Position: -25
Score: 5.3
Sequence: TAAATAACCAATTAAATTAATAT
Locus tag: BACSTE_02458
BACSTE_02458 -25 5.3 TAAATAACCAATTAAATTAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Nan-6
Ortholog function: TonB-dependent outer membrane transporter of sialic acid oligomers
Bacteroides stercoris ATCC 43183 BACSTE_02458 -25 5.3 TAAATAACCAATTAAATTAATAT
Bacteroides uniformis ATCC 8492 BACUNI_01022 -25 5.6 TTAATAACTAATTAAATTAATAT
-21 4.8 TAACTAATTAAATTAATATTTAT
Position: -44
Score: 5.5
Sequence: ATAATAAGTAATTTAATTAATTA
Position: -40
Score: 4.9
Sequence: TAAGTAATTTAATTAATTAATCT
Locus tag: BACSTE_03148
BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
-40 4.9 TAAGTAATTTAATTAATTAATCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: exbB
Ortholog function: Outer membrane transport system, transport protein ExbB
Bacteroides cellulosilyticus DSM 14838 BACCELL_01010 -44 5.7 ATAATAAACAAATTAATTAATTA
Bacteroides coprophilus DSM 18228 BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Bacteroides eggerthii DSM 20697 BACEGG_00309 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides fragilis NCTC 9343 BF3530 -43 5.5 ATAATAATAATTTAATTAATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides stercoris ATCC 43183 BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides thetaiotaomicron VPI-5482 BT2055 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides uniformis ATCC 8492 BACUNI_01658 -44 5.9 ATAATAAATAAATTAATTAATTA