Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of HTCS_Ara-1 regulog to Bacteroides thetaiotaomicron VPI-5482

Reference regulog properties
Source regulog: HTCS_Ara-1 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides thetaiotaomicron VPI-5482
Orthologous TF(s) BT0366
Regulated genes 2
Built upon 12 sites [see more]
Predicted regulatory interactions in Bacteroides thetaiotaomicron VPI-5482
Locus tag Position Score Sequence
Position: -136
Score: 7.6
Sequence: TATCCACCTCGAAAATTCATTTGTCCACCT
Locus tag: BT0365
BT0365 -136 7.6 TATCCACCTCGAAAATTCATTTGTCCACCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: lamG
Ortholog function: Concanavalin A-like lectins/glucanases superfamily
Bacteroides thetaiotaomicron VPI-5482 BT0365 -136 7.6 TATCCACCTCGAAAATTCATTTGTCCACCT
Position: -69
Score: 7
Sequence: TGTCCACCAATCGTGTTCGTATGTCCACCT
Locus tag: BT0367
BT0367 -69 7 TGTCCACCAATCGTGTTCGTATGTCCACCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: abn2
Ortholog function: Arabinan endo-1,5-alpha-L-arabinosidase
Bacteroides cellulosilyticus DSM 14838 BACCELL_05304 -268 7.8 TGTCCACCTCAAATGTTCATTTGTCCACCT
Bacteroides dorei DSM 17855 BACDOR_01716 -159 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT
Bacteroides eggerthii DSM 20697 BACEGG_01542 -285 7.4 TGTCCACCTTAAAAGGTCATATATCCACCT
Bacteroides thetaiotaomicron VPI-5482 BT0367 -69 7 TGTCCACCAATCGTGTTCGTATGTCCACCT
Bacteroides vulgatus ATCC 8482 BVU_1002 -169 7.4 TGTCCACCCTTTAAGCGATATTGTCCACCT