Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of PerR regulog to Bacteroides thetaiotaomicron VPI-5482

Reference regulog properties
Source regulog: PerR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides thetaiotaomicron VPI-5482
Orthologous TF(s) BT0215
Regulated genes 3
Built upon 51 sites [see more]
Predicted regulatory interactions in Bacteroides thetaiotaomicron VPI-5482
Locus tag Position Score Sequence
Position: -40
Score: 6.3
Sequence: ATAATTGTAATGAATACAACTTT
Locus tag: BT0215
BT0215 -40 6.3 ATAATTGTAATGAATACAACTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: perR
Ortholog function: Peroxide stress regulator PerR, Fur family
Bacteroides ovatus ATCC 8483 BACOVA_00376 -40 6.3 ATAATTGTAATGAATACAACTTT
Bacteroides thetaiotaomicron VPI-5482 BT0215 -40 6.3 ATAATTGTAATGAATACAACTTT
Position: -35
Score: 6.2
Sequence: ATATTTGTACTCATTACAAATTC
Locus tag: BT1211
BT1211 -35 6.2 ATATTTGTACTCATTACAAATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: BT1211
Ortholog function: hypothetical protein
Bacteroides cellulosilyticus DSM 14838 BACCELL_04244 -29 6.5 ATATTTGTAATGATTATAAATTT
Bacteroides dorei DSM 17855 BACDOR_04415 -34 5.9 TTCTTTGTAATTATTACAACTTT
Bacteroides eggerthii DSM 20697 BACEGG_02389 -30 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides ovatus ATCC 8483 BACOVA_03967 -35 6.2 ATATTTGTACTCATTACAAATTA
Bacteroides plebeius DSM 17135 BACPLE_02813 -28 5.5 TACTTTGTAATCATTATAAAAAT
Bacteroides stercoris ATCC 43183 BACSTE_00833 -29 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides thetaiotaomicron VPI-5482 BT1211 -35 6.2 ATATTTGTACTCATTACAAATTC
Bacteroides uniformis ATCC 8492 BACUNI_02171 70 6.5 ATATTTGTAATCATTATAATTTT
Bacteroides coprophilus DSM 18228 BACCOPRO_00522 -28 5.2 TCCTTTGTAATTATTATAAAAAT
Position: -94
Score: 6.1
Sequence: CTACTTGTAACGATTACAATTTT
Locus tag: BT1604
BT1604 -94 6.1 CTACTTGTAACGATTACAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF05140
Ortholog function: ResB protein required for cytochrome c biosynthesis
Bacteroides fragilis NCTC 9343 BF2364 -86 6.2 AAAATTGTATTTAATACAAATTA
Bacteroides thetaiotaomicron VPI-5482 BT1604 -94 6.1 CTACTTGTAACGATTACAATTTT