Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of ManR regulog to Bacteroides thetaiotaomicron VPI-5482

Reference regulog properties
Source regulog: ManR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Mannose utilization; Mannosides utilization
Effector: Mannose
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides thetaiotaomicron VPI-5482
Orthologous TF(s) BT2103
Regulated genes 3
Built upon 9 sites [see more]
Predicted regulatory interactions in Bacteroides thetaiotaomicron VPI-5482
Locus tag Position Score Sequence
Position: -108
Score: 5.8
Sequence: TAGTATGTCTGAACATATAA
Locus tag: BT2103
BT2103 -108 5.8 TAGTATGTCTGAACATATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: manR
Ortholog function: Predicted transcriptional regulator of Mannose utilization, GntR family
Bacteroides eggerthii DSM 20697 BACEGG_01984 -119 5.4 TACTTTGTTTGAACATATAT
Bacteroides ovatus ATCC 8483 BACOVA_03251 22 5.9 TTATATGTTCATACATACTT
Bacteroides thetaiotaomicron VPI-5482 BT2103 -108 5.8 TAGTATGTCTGAACATATAA
Position: -41
Score: 5.8
Sequence: TTATATGTTCAGACATACTA
Locus tag: BT2104
BT2104 -41 5.8 TTATATGTTCAGACATACTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pmi
Ortholog function: Mannose-6-phosphate isomerase (EC 5.3.1.8)
Bacteroides eggerthii DSM 20697 BACEGG_01985 -29 5.4 ATATATGTTCAAACAAAGTA
Bacteroides ovatus ATCC 8483 BACOVA_03250 -4 5.9 AAGTATGTATGAACATATAA
Bacteroides thetaiotaomicron VPI-5482 BT2104 -41 5.8 TTATATGTTCAGACATACTA
Position: -148
Score: 5.9
Sequence: CAATATGTATATACATATAG
Locus tag: BT2107
BT2107 -148 5.9 CAATATGTATATACATATAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Man-1
Ortholog function: TonB-dependent outer membrane transporter of mannan oligomers
Bacteroides thetaiotaomicron VPI-5482 BT2107 -148 5.9 CAATATGTATATACATATAG