Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of XylR regulog to Bacteroides thetaiotaomicron VPI-5482

Reference regulog properties
Source regulog: XylR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides thetaiotaomicron VPI-5482
Orthologous TF(s) BT0791
Regulated genes 2
Built upon 43 sites [see more]
Predicted regulatory interactions in Bacteroides thetaiotaomicron VPI-5482
Locus tag Position Score Sequence
Position: -162
Score: 5.3
Locus tag: BT0347
Supported by regulated orthologs from reference regulons
Ortholog gene name: tkt
Ortholog function: Transketolase (EC
Bacteroides cellulosilyticus DSM 14838 BACCELL_05612 -161 5.9 CTTATTGTATTTTAAACAAGAAG
Bacteroides eggerthii DSM 20697 BACEGG_01528 -166 5.6 CTTATTGTAATCAAAACAAGAAG
Bacteroides ovatus ATCC 8483 BACOVA_01706 -128 5.6 CTTATTGTATCACAAACAAGAAG
Bacteroides stercoris ATCC 43183 BACSTE_01846 -161 5.3 GTTATTGTATTCAAAACAGGAAG
Bacteroides thetaiotaomicron VPI-5482 BT0347 -162 5.3 CTTACTGTATTGTAAACAAGAAG
Position: -280
Score: 5.9
Position: -196
Score: 5.7
Position: -150
Score: 5.1
Position: -117
Score: 5.4
Locus tag: BT0791
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylR
Ortholog function: Predicted regulator of xylose utilization, NrtR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04758 -200 5.6 CTTATTGTACTTCCTACAATTAC
Bacteroides dorei DSM 17855 BACDOR_00865 -103 5.1 TATATTGTAGTGTATATGATAAG
Bacteroides eggerthii DSM 20697 BACEGG_02642 -208 5.1 GTTATTGTGCCTATTACAATTAC
Bacteroides fragilis NCTC 9343 BF2354 -280 5.4 CATACCCTATAAAATACAATAAG
Bacteroides ovatus ATCC 8483 BACOVA_02532 -279 6.1 CATATCGTTTAAAATACAATAAG
Bacteroides plebeius DSM 17135 BACPLE_02263 -147 5.8 CATATTGTATGAACTACAAAAAC
Bacteroides stercoris ATCC 43183 BACSTE_01380 -208 5.5 GTTATTGTATCTGCTACAATTAC
Bacteroides thetaiotaomicron VPI-5482 BT0791 -280 5.9 GATATCGTTTGAAATACAATAAG
Bacteroides uniformis ATCC 8492 BACUNI_00695 -209 5.7 CTTATTGTACTTCCTACAATTAG
Bacteroides vulgatus ATCC 8482 BVU_3955 -169 5.1 TATATTGTAGTGTATATGATAAG