Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of PerR regulog to Bacteroides vulgatus ATCC 8482

Reference regulog properties
Source regulog: PerR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Peroxide stress response; Oxidative stress response
Effector: Hydrogen peroxide
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides vulgatus ATCC 8482
Orthologous TF(s) BVU_2366
Regulated genes 7
Built upon 51 sites [see more]
Predicted regulatory interactions in Bacteroides vulgatus ATCC 8482
Locus tag Position Score Sequence
Position: -55
Score: 6
Sequence: GCAAATGTAATAATTACAATTTA
Locus tag: BVU_0847
BVU_0847 -55 6 GCAAATGTAATAATTACAATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ahpC
Ortholog function: Alkyl hydroperoxide reductase protein C (EC 1.6.4.-)
Bacteroides dorei DSM 17855 BACDOR_04898 -55 6 GCAAATGTAATAATTACAATTTA
Bacteroides vulgatus ATCC 8482 BVU_0847 -55 6 GCAAATGTAATAATTACAATTTA
Bacteroides coprophilus DSM 18228 BACCOPRO_03297 -55 6.1 TGCATTGTAATAATTACAAATTT
Position: -92
Score: 6.4
Sequence: GTAATTGTAATAAATACAATTTT
Locus tag: BVU_1137
BVU_1137 -92 6.4 GTAATTGTAATAAATACAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: rbr2
Ortholog function: Rubrerythrin
Bacteroides dorei DSM 17855 BACDOR_01950 -93 6.7 ATAATTGTAATGAATACAATTTT
Bacteroides plebeius DSM 17135 BACPLE_00297 -94 6.7 AAAATTGTAATGATTTCAAATTT
Bacteroides vulgatus ATCC 8482 BVU_1137 -92 6.4 GTAATTGTAATAAATACAATTTT
Position: -19
Score: 5.6
Sequence: AAAACTGTAATAATTATAAATGG
Locus tag: BVU_1959
BVU_1959 -19 5.6 AAAACTGTAATAATTATAAATGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: acn
Ortholog function: Aconitate hydratase (EC 4.2.1.3)
Bacteroides cellulosilyticus DSM 14838 BACCELL_00993 -47 6.1 TAATTTGTAATCTTTACAATATT
Bacteroides dorei DSM 17855 BACDOR_03102 -25 5.9 AAAACTGTAATAATTATAAATTG
Bacteroides eggerthii DSM 20697 BACEGG_00294 -48 6.1 TAATTTGTAATCTTTACAATATT
Bacteroides stercoris ATCC 43183 BACSTE_03162 -45 6.1 TAATTTGTAATATTTACAATATT
Bacteroides uniformis ATCC 8492 BACUNI_01674 -45 6 TAATTTGTAATCTTTACAATAAT
Bacteroides vulgatus ATCC 8482 BVU_1959 -19 5.6 AAAACTGTAATAATTATAAATGG
Position: -30
Score: 6.1
Sequence: AAAATTGTAATAGTTACAAAAAG
Locus tag: BVU_2366
BVU_2366 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: perR
Ortholog function: Peroxide stress regulator PerR, Fur family
Bacteroides cellulosilyticus DSM 14838 BACCELL_05678 -36 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides dorei DSM 17855 BACDOR_03683 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides eggerthii DSM 20697 BACEGG_01512 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides fragilis NCTC 9343 BF3019 -39 6.8 AAAATTGTAATGAATACAATTTT
Bacteroides plebeius DSM 17135 BACPLE_02660 -33 5.9 AGAATTGTAACAATTACATAATT
Bacteroides stercoris ATCC 43183 BACSTE_01825 -37 6.6 AAAAATGTAATTATTACAAGTTT
Bacteroides uniformis ATCC 8492 BACUNI_01378 -38 6.6 AAAAATGTAATAATTACAAGTTT
Bacteroides vulgatus ATCC 8482 BVU_2366 -30 6.1 AAAATTGTAATAGTTACAAAAAG
Bacteroides coprophilus DSM 18228 BACCOPRO_01403 -33 6.1 AAAATTGTAATAGTTACAGAATT
Position: -40
Score: 5.7
Sequence: ATATTTGCAACAGTTACAATTTA
Locus tag: BVU_2754
BVU_2754 -40 5.7 ATATTTGCAACAGTTACAATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ftn
Ortholog function: Ferritin
Bacteroides dorei DSM 17855 BACDOR_04357 -41 5.7 ATATTTGCAACAGTTACAATTTA
Bacteroides vulgatus ATCC 8482 BVU_2754 -40 5.7 ATATTTGCAACAGTTACAATTTA
Position: -276
Score: 5.9
Sequence: TTCTTTGTAATTATTACAACTTT
Locus tag: BVU_2799
BVU_2799 -276 5.9 TTCTTTGTAATTATTACAACTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cydA
Ortholog function: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04245 -29 6.5 ATATTTGTAATGATTATAAATTT
Bacteroides dorei DSM 17855 BACDOR_04414 -34 5.9 TTCTTTGTAATTATTACAACTTT
Bacteroides eggerthii DSM 20697 BACEGG_02390 -30 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides ovatus ATCC 8483 BACOVA_03968 -35 6.2 ATATTTGTACTCATTACAAATTA
Bacteroides stercoris ATCC 43183 BACSTE_00831 -29 6.2 ATATTTGTAATGATTATAATTTG
Bacteroides thetaiotaomicron VPI-5482 BT1210 -35 6.2 ATATTTGTACTCATTACAAATTC
Bacteroides uniformis ATCC 8492 BACUNI_02172 70 6.5 ATATTTGTAATCATTATAATTTT
Bacteroides vulgatus ATCC 8482 BVU_2799 -276 5.9 TTCTTTGTAATTATTACAACTTT
Position: -44
Score: 5.7
Sequence: AAATTTGTTATCATTACAGTATC
Locus tag: BVU_3944
BVU_3944 -44 5.7 AAATTTGTTATCATTACAGTATC
Supported by regulated orthologs from reference regulons
Ortholog gene name: tpx
Ortholog function: Thiol peroxidase, Tpx-type (EC 1.11.1.15)
Bacteroides dorei DSM 17855 BACDOR_00877 -44 5.7 AAATTTGTTATCATTACAGTATC
Bacteroides uniformis ATCC 8492 BACUNI_04341 -35 5 TAATTTGTTATGTATACATATAA
Bacteroides vulgatus ATCC 8482 BVU_3944 -44 5.7 AAATTTGTTATCATTACAGTATC
Bacteroides coprophilus DSM 18228 BACCOPRO_01040 -56 6.3 ATATTTGTAATTATTACATATCT