Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Crp regulog to Parabacteroides merdae ATCC 43184

Reference regulog properties
Source regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Parabacteroides merdae ATCC 43184
Orthologous TF(s) PARMER_03972
Regulated genes 5
Built upon 113 sites [see more]
Predicted regulatory interactions in Parabacteroides merdae ATCC 43184
Locus tag Position Score Sequence
Position: -111
Score: 4.3
Sequence: ATGTATGTTAAATAACGGGCTT
Locus tag: PARMER_00443
PARMER_00443 -111 4.3 ATGTATGTTAAATAACGGGCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylR
Ortholog function: Predicted regulator of xylose utilization, NrtR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04758 -83 4.9 AATAGTGCTTTATAACATAATA
Bacteroides dorei DSM 17855 BACDOR_00865 -34 4.8 AATAGTGTTTTAGAACATAATA
Bacteroides eggerthii DSM 20697 BACEGG_02642 -92 4.8 AATAATGCTTTGTAACATATCA
Bacteroides fragilis NCTC 9343 BF2354 -81 4.6 AACAATGCTTTATAGCATATTA
Bacteroides ovatus ATCC 8483 BACOVA_02532 -80 4.2 AACAATGTTTTATAGCATGTTT
Bacteroides stercoris ATCC 43183 BACSTE_01380 -92 4.3 AATAATGCTTTATAACATTGTA
Bacteroides thetaiotaomicron VPI-5482 BT0791 -81 4.2 AACAATGTTTTATAGCATGTCA
Bacteroides uniformis ATCC 8492 BACUNI_00695 -92 4.1 AATAATGCTTTATAATATTATA
Bacteroides vulgatus ATCC 8482 BVU_3955 -100 4.5 AATAGTGTTTTGGAACATAATA
Position: -89
Score: 4.2
Sequence: ATAAATCTAAAAAAACATAAAA
Locus tag: PARMER_00923
PARMER_00923 -89 4.2 ATAAATCTAAAAAAACATAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylA
Ortholog function: Xylose isomerase (EC 5.3.1.5)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04760 -83 4.9 AATAGTGCTTTATAACATAATA
Bacteroides dorei DSM 17855 BACDOR_00867 -34 4.8 AATAGTGTTTTAGAACATAATA
Bacteroides eggerthii DSM 20697 BACEGG_02644 -92 4.8 AATAATGCTTTGTAACATATCA
Bacteroides fragilis NCTC 9343 BF2356 -81 4.6 AACAATGCTTTATAGCATATTA
Bacteroides ovatus ATCC 8483 BACOVA_02534 -80 4.2 AACAATGTTTTATAGCATGTTT
Bacteroides thetaiotaomicron VPI-5482 BT0793 -81 4.2 AACAATGTTTTATAGCATGTCA
Bacteroides uniformis ATCC 8492 BACUNI_00693 -92 4.1 AATAATGCTTTATAATATTATA
Bacteroides vulgatus ATCC 8482 BVU_3953 -100 4.5 AATAGTGTTTTGGAACATAATA
Position: -20
Score: 4.3
Sequence: AAGTATGTTATATAGCAGTCGT
Locus tag: PARMER_03972
PARMER_03972 -20 4.3 AAGTATGTTATATAGCAGTCGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: transcriptional regulator, Crp/Fnr family
Bacteroides cellulosilyticus DSM 14838 BACCELL_03476 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855 BACDOR_01607 -35 4.1 ATTTGTGCTCTATAACACGGTT
Bacteroides eggerthii DSM 20697 BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides fragilis NCTC 9343 BF0954 -33 4.6 ATTTGTGCTTTATAACACAGTT
Bacteroides ovatus ATCC 8483 BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides plebeius DSM 17135 BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183 BACSTE_03515 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482 BT4338 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides uniformis ATCC 8492 BACUNI_04721 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides vulgatus ATCC 8482 BVU_3580 -35 4.1 ATTTGTGCTCTATAACACGGTT
Position: -90
Score: 4.9
Sequence: CTTTATGCTAAAAAACATCTAT
Locus tag: PARMER_04062
PARMER_04062 -90 4.9 CTTTATGCTAAAAAACATCTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF09719
Ortholog function: Putative redox-active protein (C_GCAxxG_C_C)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04404 -142 5.6 TTTTATGACATATAACATAAAA
-110 5.8 TAATGTGTTATATAACATAAAT
Bacteroides dorei DSM 17855 BACDOR_00927 -110 4.6 AAAAGTGTTGAATAACATAATT
Bacteroides eggerthii DSM 20697 BACEGG_02494 -109 5.6 TAACGTGTTATATAACATAAAA
Bacteroides fragilis NCTC 9343 BF2582 -99 5.9 TAATCTGTTATATAACATAATT
Bacteroides ovatus ATCC 8483 BACOVA_02257 -107 5.3 TAAAGTGTTATATAACATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_01186 -110 5.4 TAACGTGCTATATAACATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_02281 -105 5.3 TAACGTGTTGTATAACATAAAT
Bacteroides vulgatus ATCC 8482 BVU_3908 -104 4.6 AAAAGTGTTGAATAACATAATT