Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of SusR2 regulog to Bacteroides ovatus ATCC 8483

Reference regulog properties
Source regulog: SusR2 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: repressor
Biological process: Starch utilization
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides ovatus ATCC 8483
Orthologous TF(s) BACOVA_02788
Regulated genes 1
Built upon 10 sites [see more]
Predicted regulatory interactions in Bacteroides ovatus ATCC 8483
Locus tag Position Score Sequence
Position: -204
Score: 6.6
Locus tag: BACOVA_02787
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC2
Ortholog function: SusC2, outer membrane protein involved in starch binding
Bacteroides cellulosilyticus DSM 14838 BACCELL_04952 -208 5.7 ATTTTTACTACTTTTTTGGA
Bacteroides ovatus ATCC 8483 BACOVA_02787 -204 6.6 AAAATCACTACTTTTTTAGT
Bacteroides thetaiotaomicron VPI-5482 BT3090 -186 6.1 AAATCCACTACTTTTTTAGC
Bacteroides uniformis ATCC 8492 BACUNI_01942 -206 6.2 ATTTTCACTACTTTTTTAGT