Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides ovatus ATCC 8483

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides ovatus ATCC 8483
Orthologous TF(s) BACOVA_01791
Regulated genes 4
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides ovatus ATCC 8483
Locus tag Position Score Sequence
Position: -39
Score: 4.8
Sequence: ATAATAATCAATTAATTAATCTT
Locus tag: BACOVA_00648
BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: exbB
Ortholog function: Outer membrane transport system, transport protein ExbB
Bacteroides cellulosilyticus DSM 14838 BACCELL_01010 -44 5.7 ATAATAAACAAATTAATTAATTA
Bacteroides coprophilus DSM 18228 BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Bacteroides eggerthii DSM 20697 BACEGG_00309 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides fragilis NCTC 9343 BF3530 -43 5.5 ATAATAATAATTTAATTAATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides stercoris ATCC 43183 BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides thetaiotaomicron VPI-5482 BT2055 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides uniformis ATCC 8492 BACUNI_01658 -44 5.9 ATAATAAATAAATTAATTAATTA
Position: -257
Score: 5.9
Sequence: TAGATAATAAAATATTTTATTAA
Position: -254
Score: 6.3
Sequence: ATAATAAAATATTTTATTAATAA
Position: -54
Score: 4.8
Sequence: TATATTAATAAAAAAATTAATTA
Position: -53
Score: 5.4
Sequence: ATATTAATAAAAAAATTAATTAT
Position: -50
Score: 5.8
Sequence: TTAATAAAAAAATTAATTATCTT
Locus tag: BACOVA_01791
BACOVA_01791 -257 5.9 TAGATAATAAAATATTTTATTAA
-254 6.3 ATAATAAAATATTTTATTAATAA
-54 4.8 TATATTAATAAAAAAATTAATTA
-53 5.4 ATATTAATAAAAAAATTAATTAT
-50 5.8 TTAATAAAAAAATTAATTATCTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanR
Ortholog function: Putative N-acetylglucosamine repressor of sialic acid catabolism, ROK family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04950 -37 5.5 ATATTAATAAAATTATTAAGTAT
Bacteroides dorei DSM 17855 BACDOR_00695 -217 5.5 AAACTAAATTTATTTATTAATAA
Bacteroides eggerthii DSM 20697 BACEGG_02291 -58 6.2 TAATTAATAAATTATTTTATTAT
Bacteroides fragilis NCTC 9343 BF1711 -52 4.8 TTAATAAACAAATTAACTATCTT
Bacteroides ovatus ATCC 8483 BACOVA_01791 -50 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides plebeius DSM 17135 BACPLE_00597 -88 5.4 TAAATATAATAATTTATTAATGA
Bacteroides stercoris ATCC 43183 BACSTE_01902 -242 6 TATATAATAAATTATTTTATTAT
Bacteroides thetaiotaomicron VPI-5482 BT0433 -51 5.8 TTAATAAAAAAATTAATTATCTT
Bacteroides uniformis ATCC 8492 BACUNI_02075 -52 5.1 AATTTACAAAATTATTTTAGTAT
Bacteroides vulgatus ATCC 8482 BVU_4116 -190 5.5 AAACTAAATTTATTTATTAATAA
Position: -103
Score: 6.3
Sequence: TTATTAATAAAATATTTTATTAT
Locus tag: BACOVA_01792
BACOVA_01792 -103 6.3 TTATTAATAAAATATTTTATTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: BT0434
Ortholog function: NTP pyrophosphohydrolases including oxidative damage repair enzymes
Bacteroides ovatus ATCC 8483 BACOVA_01792 -103 6.3 TTATTAATAAAATATTTTATTAT
-100 5.9 TTAATAAAATATTTTATTATCTA