Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Crp regulog to Bacteroides ovatus ATCC 8483

Reference regulog properties
Source regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides ovatus ATCC 8483
Orthologous TF(s) BACOVA_05152
Regulated genes 7
Built upon 113 sites [see more]
Predicted regulatory interactions in Bacteroides ovatus ATCC 8483
Locus tag Position Score Sequence
Position: -195
Score: 5
Sequence: ATATATGTTACACAAAAGATTA
Position: -66
Score: 5.4
Sequence: TTTCATGCTTTAAAACAGAATT
Locus tag: BACOVA_02079
BACOVA_02079 -195 5 ATATATGTTACACAAAAGATTA
-66 5.4 TTTCATGCTTTAAAACAGAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF01694
Ortholog function: Peptidase S54, rhomboid domain
Bacteroides cellulosilyticus DSM 14838 BACCELL_02471 -196 5 TAATATGTTACACAAAAGATAT
-62 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides dorei DSM 17855 BACDOR_01705 -71 6.2 TTTTCTGTTATATAACAGAATA
Bacteroides eggerthii DSM 20697 BACEGG_03101 -188 5.3 TAATATGTTACACAAAAGAAAA
-61 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides fragilis NCTC 9343 BF4221 -227 5 ATATATGTTACACAAAAGATAT
-105 5.7 TTTTCTGTTGTAGAACAGAATT
Bacteroides ovatus ATCC 8483 BACOVA_02079 -195 5 ATATATGTTACACAAAAGATTA
-66 5.4 TTTCATGCTTTAAAACAGAATT
Bacteroides stercoris ATCC 43183 BACSTE_02140 -188 4.3 TTAATTGTTACACAAAAGAAAA
-61 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides thetaiotaomicron VPI-5482 BT2831 -192 4.9 ATATATGTTACACAAAAGATTT
-69 5 TTCCATGCTTTAAAACAGAATT
Bacteroides uniformis ATCC 8492 BACUNI_03999 -230 5 TAATATGTTACACAAAAGATAT
-97 5.8 TTTTCTGTTATAGAACAGAATT
Bacteroides vulgatus ATCC 8482 BVU_0995 -71 6.2 TTTTCTGTTATATAACAGAATA
Position: -80
Score: 4.2
Sequence: AACAATGTTTTATAGCATGTTT
Locus tag: BACOVA_02532
BACOVA_02532 -80 4.2 AACAATGTTTTATAGCATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylR
Ortholog function: Predicted regulator of xylose utilization, NrtR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04758 -83 4.9 AATAGTGCTTTATAACATAATA
Bacteroides dorei DSM 17855 BACDOR_00865 -34 4.8 AATAGTGTTTTAGAACATAATA
Bacteroides eggerthii DSM 20697 BACEGG_02642 -92 4.8 AATAATGCTTTGTAACATATCA
Bacteroides fragilis NCTC 9343 BF2354 -81 4.6 AACAATGCTTTATAGCATATTA
Bacteroides ovatus ATCC 8483 BACOVA_02532 -80 4.2 AACAATGTTTTATAGCATGTTT
Bacteroides stercoris ATCC 43183 BACSTE_01380 -92 4.3 AATAATGCTTTATAACATTGTA
Bacteroides thetaiotaomicron VPI-5482 BT0791 -81 4.2 AACAATGTTTTATAGCATGTCA
Bacteroides uniformis ATCC 8492 BACUNI_00695 -92 4.1 AATAATGCTTTATAATATTATA
Bacteroides vulgatus ATCC 8482 BVU_3955 -100 4.5 AATAGTGTTTTGGAACATAATA
Position: -66
Score: 6.3
Sequence: TTTTATGTTATTTAGCATAAAA
Locus tag: BACOVA_02567
BACOVA_02567 -66 6.3 TTTTATGTTATTTAGCATAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: serB
Ortholog function: Phosphoserine phosphatase (EC 3.1.3.3)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04825 -163 5.5 TTTCATGTTATATAACATGTTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01694 -134 5.6 AATTATGCTTTTAAACATAAAT
Bacteroides dorei DSM 17855 BACDOR_02848 -116 6.1 AAATATGTTATATAGCATAAAA
Bacteroides eggerthii DSM 20697 BACEGG_02676 -74 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides fragilis NCTC 9343 BF2389 -71 6.2 TTTTATGTTATTTAGCATAAAT
Bacteroides ovatus ATCC 8483 BACOVA_02567 -66 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides stercoris ATCC 43183 BACSTE_01424 -74 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides thetaiotaomicron VPI-5482 BT0832 -67 6.3 TTTTATGTTATTTAGCATAAAA
Bacteroides uniformis ATCC 8492 BACUNI_00649 -75 6.2 TTTTATGTTATTTAGCATAAAT
Bacteroides vulgatus ATCC 8482 BVU_3158 -116 6.1 AAATATGTTATATAGCATAAAA
Position: -100
Score: 5.8
Sequence: TTTTCTGCTATAAAACATATCA
Locus tag: BACOVA_03849
BACOVA_03849 -100 5.8 TTTTCTGCTATAAAACATATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: fucR
Ortholog function: Transcriptional regulator of fucose utilization, GntR family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04988 -124 5.2 TTATATGCTGCAAAACATATCC
Bacteroides dorei DSM 17855 BACDOR_02265 -114 5.1 TCTTGTGTTATAAAACATACCA
Bacteroides fragilis NCTC 9343 BF0210 -114 5.6 TTTGATGTTGTATAACATACCA
Bacteroides ovatus ATCC 8483 BACOVA_03849 -100 5.8 TTTTCTGCTATAAAACATATCA
Bacteroides plebeius DSM 17135 BACPLE_02898 -93 4.6 AAATCTGTTCTTAAACATAGCT
Bacteroides thetaiotaomicron VPI-5482 BT1272 -100 5.5 TTTCCTGCTATAGAACATATTA
Bacteroides vulgatus ATCC 8482 BVU_1374 -114 5 TCTTGTGTTATAAAACATACCT
Position: -33
Score: 4.8
Sequence: TTTTGTGCTGTATAACACAGTT
Locus tag: BACOVA_05152
BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: transcriptional regulator, Crp/Fnr family
Bacteroides cellulosilyticus DSM 14838 BACCELL_03476 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855 BACDOR_01607 -35 4.1 ATTTGTGCTCTATAACACGGTT
Bacteroides eggerthii DSM 20697 BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides fragilis NCTC 9343 BF0954 -33 4.6 ATTTGTGCTTTATAACACAGTT
Bacteroides ovatus ATCC 8483 BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides plebeius DSM 17135 BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183 BACSTE_03515 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482 BT4338 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides uniformis ATCC 8492 BACUNI_04721 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides vulgatus ATCC 8482 BVU_3580 -35 4.1 ATTTGTGCTCTATAACACGGTT