Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of XylR regulog to Bacteroides cellulosilyticus DSM 14838

Reference regulog properties
Source regulog: XylR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides cellulosilyticus DSM 14838
Orthologous TF(s) BACCELL_04758
Regulated genes 1
Built upon 43 sites [see more]
Predicted regulatory interactions in Bacteroides cellulosilyticus DSM 14838
Locus tag Position Score Sequence
Position: -161
Score: 5.9
Locus tag: BACCELL_05612
Supported by regulated orthologs from reference regulons
Ortholog gene name: tkt
Ortholog function: Transketolase (EC
Bacteroides cellulosilyticus DSM 14838 BACCELL_05612 -161 5.9 CTTATTGTATTTTAAACAAGAAG
Bacteroides eggerthii DSM 20697 BACEGG_01528 -166 5.6 CTTATTGTAATCAAAACAAGAAG
Bacteroides ovatus ATCC 8483 BACOVA_01706 -128 5.6 CTTATTGTATCACAAACAAGAAG
Bacteroides stercoris ATCC 43183 BACSTE_01846 -161 5.3 GTTATTGTATTCAAAACAGGAAG
Bacteroides thetaiotaomicron VPI-5482 BT0347 -162 5.3 CTTACTGTATTGTAAACAAGAAG