Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of UxaR regulog to Bacteroides cellulosilyticus DSM 14838

Reference regulog properties
Source regulog: UxaR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Glucuronate utilization; Galacturonate utilization
Effector: Glucuronate; Galacturonate
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides cellulosilyticus DSM 14838
Orthologous TF(s) BACCELL_04799
Regulated genes 2
Built upon 12 sites [see more]
Predicted regulatory interactions in Bacteroides cellulosilyticus DSM 14838
Locus tag Position Score Sequence
Position: -166
Score: 6.1
Sequence: GCAAAGATACGAATTATTTT
Locus tag: BACCELL_04798
BACCELL_04798 -166 6.1 GCAAAGATACGAATTATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: uxaC
Ortholog function: Uronate isomerase (EC 5.3.1.12)
Bacteroides cellulosilyticus DSM 14838 BACCELL_04798 -166 6.1 GCAAAGATACGAATTATTTT
Bacteroides eggerthii DSM 20697 BACEGG_02664 -166 6 GCAAAGATACGAATAATTTT
Bacteroides ovatus ATCC 8483 BACOVA_02558 -165 6.1 GCAAATATACGAATTATTTT
Bacteroides stercoris ATCC 43183 BACSTE_01410 -166 6.1 GCAAAGATACGAATTATTTT
Bacteroides thetaiotaomicron VPI-5482 BT_0823 -166 6.1 GCAAATATACGAATTATTTT
Bacteroides uniformis ATCC 8492 BACUNI_00659 -166 6.1 GCAAAGATACGAATTATTTT
Position: -91
Score: 6.1
Sequence: AAAATAATTCGTATCTTTGC
Locus tag: BACCELL_04799
BACCELL_04799 -91 6.1 AAAATAATTCGTATCTTTGC
Supported by regulated orthologs from reference regulons
Ortholog gene name: uxaR
Ortholog function: Predicted transcriptional regulator for galacturonate catabolism, LacI family
Bacteroides cellulosilyticus DSM 14838 BACCELL_04799 -91 6.1 AAAATAATTCGTATCTTTGC
Bacteroides eggerthii DSM 20697 BACEGG_02665 -85 6 AAAATTATTCGTATCTTTGC
Bacteroides ovatus ATCC 8483 BACOVA_02559 -53 6.1 AAAATAATTCGTATATTTGC
Bacteroides stercoris ATCC 43183 BACSTE_01411 -84 6.1 AAAATAATTCGTATCTTTGC
Bacteroides thetaiotaomicron VPI-5482 BT0824 -92 6.1 AAAATAATTCGTATATTTGC
Bacteroides uniformis ATCC 8492 BACUNI_00658 -87 6.1 AAAATAATTCGTATCTTTGC