Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of HTCS_Ara-1 regulog to Prevotella copri DSM 18205

Reference regulog properties
Source regulog: HTCS_Ara-1 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Phylum: Bacteroidetes
Propagated regulon:
Target genome Prevotella copri DSM 18205
Orthologous TF(s) PREVCOP_02267
Regulated genes 1
Built upon 12 sites [see more]
Predicted regulatory interactions in Prevotella copri DSM 18205
Locus tag Position Score Sequence
Position: -192
Score: 7.3
Sequence: TGTCCACCTATAAAACCCAATTGTCCACCC
Locus tag: PREVCOP_02266
PREVCOP_02266 -192 7.3 TGTCCACCTATAAAACCCAATTGTCCACCC
Supported by regulated orthologs from reference regulons
Ortholog gene name: susC_Ara-3
Ortholog function: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Bacteroides dorei DSM 17855 BACDOR_01719 -291 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC
Bacteroides eggerthii DSM 20697 BACEGG_01540 -349 6.4 TCTCTACACTTAAAATTCGTTTATCCACCT
-328 7.3 TATCCACCTCTAAAACCCATTTGTCCACCC
Bacteroides plebeius DSM 17135 BACPLE_00643 -224 7.8 TATCCACCTATAAAATTCGTTTGTCCACCT
Bacteroides vulgatus ATCC 8482 BVU_1005 -265 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC