Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Crp regulog to Prevotella copri DSM 18205

Reference regulog properties
Source regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Prevotella copri DSM 18205
Orthologous TF(s) PREVCOP_00583
Regulated genes 1
Built upon 113 sites [see more]
Predicted regulatory interactions in Prevotella copri DSM 18205
Locus tag Position Score Sequence
Position: -152
Score: 4.1
Sequence: TTTTTTGTGGTATAACAAAGTT
Position: -99
Score: 5.9
Sequence: TTTTATGTTTTAAAACATATTT
Locus tag: PREVCOP_00583
PREVCOP_00583 -152 4.1 TTTTTTGTGGTATAACAAAGTT
-99 5.9 TTTTATGTTTTAAAACATATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: transcriptional regulator, Crp/Fnr family
Bacteroides cellulosilyticus DSM 14838 BACCELL_03476 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855 BACDOR_01607 -35 4.1 ATTTGTGCTCTATAACACGGTT
Bacteroides eggerthii DSM 20697 BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides fragilis NCTC 9343 BF0954 -33 4.6 ATTTGTGCTTTATAACACAGTT
Bacteroides ovatus ATCC 8483 BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides plebeius DSM 17135 BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183 BACSTE_03515 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482 BT4338 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides uniformis ATCC 8492 BACUNI_04721 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides vulgatus ATCC 8482 BVU_3580 -35 4.1 ATTTGTGCTCTATAACACGGTT