Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Parabacteroides johnsonii DSM 18315

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Parabacteroides johnsonii DSM 18315
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 59 sites [see more]
Predicted regulatory interactions in Parabacteroides johnsonii DSM 18315
Locus tag Position Score Sequence
Position: -79
Score: 5.8
Sequence: ATATTATTAAAATATTTTATTTA
Position: -76
Score: 5.9
Sequence: TTATTAAAATATTTTATTTATAT
Locus tag: PRABACTJOHN_00548
PRABACTJOHN_00548 -79 5.8 ATATTATTAAAATATTTTATTTA
-76 5.9 TTATTAAAATATTTTATTTATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Bacteroides coprophilus DSM 18228 BACCOPRO_02518 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855 BACDOR_00694 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides eggerthii DSM 20697 BACEGG_02294 -85 6 TTAATAAAATAATTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1712 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00275 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01905 -94 5.8 TATTTAATAAAATAAATTATTAA
Bacteroides vulgatus ATCC 8482 BVU_4117 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT