Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of NanR regulog to Bacteroides coprophilus DSM 18228

Reference regulog properties
Source regulog: NanR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Sialic acid utilization; N-acetylglucosamine utilization
Effector: N-acetylglucosamine; N-acetylneuraminic acid
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides coprophilus DSM 18228
Orthologous TF(s) BACCOPRO_02516
Regulated genes 2
Built upon 59 sites [see more]
Predicted regulatory interactions in Bacteroides coprophilus DSM 18228
Locus tag Position Score Sequence
Position: -43
Score: 5
Sequence: TTTATAAACTATTAATTAATTAA
Locus tag: BACCOPRO_02433
BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: exbB
Ortholog function: Outer membrane transport system, transport protein ExbB
Bacteroides cellulosilyticus DSM 14838 BACCELL_01010 -44 5.7 ATAATAAACAAATTAATTAATTA
Bacteroides coprophilus DSM 18228 BACCOPRO_02433 -43 5 TTTATAAACTATTAATTAATTAA
Bacteroides eggerthii DSM 20697 BACEGG_00309 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides fragilis NCTC 9343 BF3530 -43 5.5 ATAATAATAATTTAATTAATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00648 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides stercoris ATCC 43183 BACSTE_03148 -44 5.5 ATAATAAGTAATTTAATTAATTA
Bacteroides thetaiotaomicron VPI-5482 BT2055 -39 4.8 ATAATAATCAATTAATTAATCTT
Bacteroides uniformis ATCC 8492 BACUNI_01658 -44 5.9 ATAATAAATAAATTAATTAATTA
Position: -33
Score: 5.6
Sequence: ATATAAATAAATAATTTTATTAA
Position: -30
Score: 5.8
Sequence: TAAATAAATAATTTTATTAAATA
Locus tag: BACCOPRO_02518
BACCOPRO_02518 -33 5.6 ATATAAATAAATAATTTTATTAA
-30 5.8 TAAATAAATAATTTTATTAAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Bacteroides coprophilus DSM 18228 BACCOPRO_02518 -30 5.8 TAAATAAATAATTTTATTAAATA
Bacteroides dorei DSM 17855 BACDOR_00694 -111 5.5 TTATTAATAAATAAATTTAGTTT
-40 4.8 TAAGTAATATAAAATATTCATTT
Bacteroides eggerthii DSM 20697 BACEGG_02294 -85 6 TTAATAAAATAATTTATTAAATA
Bacteroides fragilis NCTC 9343 BF1712 -150 6.3 TTATTAATAAAATATTTTATTAT
-41 5.3 ATATTAAAAATCTATATCATTAA
Bacteroides ovatus ATCC 8483 BACOVA_00275 -194 4.9 AAAATAACTAAATATATTAAACT
Bacteroides stercoris ATCC 43183 BACSTE_01905 -94 5.8 TATTTAATAAAATAAATTATTAA
Bacteroides vulgatus ATCC 8482 BVU_4117 -111 5.5 TTATTAATAAATAAATTTAGTTT
-108 5.2 TTAATAAATAAATTTAGTTTTTA
-40 4.8 TAAGTAATATAAAATATTCATTT