Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Propagation of Crp regulog to Bacteroides coprophilus DSM 18228

Reference regulog properties
Source regulog: Crp - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process:
Effector:
Phylum: Bacteroidetes
Propagated regulon:
Target genome Bacteroides coprophilus DSM 18228
Orthologous TF(s) BACCOPRO_01276
Regulated genes 3
Built upon 113 sites [see more]
Predicted regulatory interactions in Bacteroides coprophilus DSM 18228
Locus tag Position Score Sequence
Position: -33
Score: 4.6
Sequence: TTTTGTGCTTAATAACACGATT
Locus tag: BACCOPRO_01276
BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: crp
Ortholog function: transcriptional regulator, Crp/Fnr family
Bacteroides cellulosilyticus DSM 14838 BACCELL_03476 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides coprophilus DSM 18228 BACCOPRO_01276 -33 4.6 TTTTGTGCTTAATAACACGATT
Bacteroides dorei DSM 17855 BACDOR_01607 -35 4.1 ATTTGTGCTCTATAACACGGTT
Bacteroides eggerthii DSM 20697 BACEGG_01340 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides fragilis NCTC 9343 BF0954 -33 4.6 ATTTGTGCTTTATAACACAGTT
Bacteroides ovatus ATCC 8483 BACOVA_05152 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides plebeius DSM 17135 BACPLE_02167 -16 4.1 CTTTGTGCTTAATAACATGGTT
Bacteroides stercoris ATCC 43183 BACSTE_03515 -33 4.6 ATTTGTGCTGTACAACACAGTT
Bacteroides thetaiotaomicron VPI-5482 BT4338 -33 4.8 TTTTGTGCTGTATAACACAGTT
Bacteroides uniformis ATCC 8492 BACUNI_04721 -33 4.7 ATTTGTGCTGTATAACACAGTT
Bacteroides vulgatus ATCC 8482 BVU_3580 -35 4.1 ATTTGTGCTCTATAACACGGTT
Position: -53
Score: 5.5
Sequence: TAATATGTTGGAAAACATATAA
Locus tag: BACCOPRO_03681
BACCOPRO_03681 -53 5.5 TAATATGTTGGAAAACATATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: PF10438
Ortholog function: Cyclo-malto-dextrinase C-terminal domain, involved in stabilisation of acitve sites
Bacteroides coprophilus DSM 18228 BACCOPRO_03681 -53 5.5 TAATATGTTGGAAAACATATAA
Bacteroides dorei DSM 17855 BACDOR_03939 -58 5.4 AGATATGCTGAAAAACATATAA
Bacteroides vulgatus ATCC 8482 BVU_2487 -58 5.4 AGATATGCTGAAAAACATATAA