Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing licB gene

Properties
Regulog: LicR - Bacillales
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Beta-glucosides utilization
Effector: HPr, phosphocarrier protein; LicB, lichenan-specific enzyme IIB PTS component
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -109
Score: 6.17754
Sequence: TTTTCCGTTAACAGCGGAAAA
Locus tag: RBAM_035790
Name: licB
Funciton: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: RBAM_035780
Name: licC
Funciton: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
Locus tag: RBAM_035770
Name: licA
Funciton: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
Locus tag: RBAM_035760
Name: licH
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
licB-licC-licA-licH -109 6.2 TTTTCCGTTAACAGCGGAAAA RBAM_035790
Bacillus clausii KSM-K16
Position: -123
Score: 5.43733
Sequence: TTTTCCGTTTATATGGCTAAA
Locus tag: ABC0481
Name: licB
Funciton: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: ABC0482
Name: licC
Funciton: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
Locus tag: ABC0483
Name: licA
Funciton: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
Locus tag: ABC0484
Name: licH
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: ABC0485
Name: licR
Funciton: Transcriptional antiterminator of lichenan operon, BglG family
licB-licC-licA-licH-licR -123 5.4 TTTTCCGTTTATATGGCTAAA ABC0481
Bacillus pumilus SAFR-032
Position: -105
Score: 5.67937
Sequence: TTTCCGCTTCCTAAAGGAAAA
Locus tag: BPUM_3506
Name: licB
Funciton: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: BPUM_3505
Name: licC
Funciton: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
Locus tag: BPUM_3504
Name: licA
Funciton: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
Locus tag: BPUM_3503
Name: licH
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
licB-licC-licA-licH -105 5.7 TTTCCGCTTCCTAAAGGAAAA BPUM_3506
Bacillus subtilis subsp. subtilis str. 168
Position: -111
Score: 5.48627
Sequence: TTTTCCGTTGCCTGCGGAAAA
Locus tag: BSU38590
Name: licB
Funciton: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: BSU38580
Name: licC
Funciton: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
Locus tag: BSU38570
Name: licA
Funciton: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
Locus tag: BSU38560
Name: licH
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
licB-licC-licA-licH -111 5.5 TTTTCCGTTGCCTGCGGAAAA BSU38590
Oceanobacillus iheyensis HTE831
Position: -97
Score: 5.69611
Sequence: TTTTCCGTTACACAGCGGAAA
Locus tag: OB2760
Name: licB
Funciton: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: OB2761
Name: licC
Funciton: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
Locus tag: OB2762
Name: licA
Funciton: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
Locus tag: OB2763
Name: licH
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: OB2764
Name: null
Funciton: Transcriptional antiterminator of lichenan operon, BglG family
licB-licC-licA-licH-OB2764 -97 5.7 TTTTCCGTTACACAGCGGAAA OB2760