Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing htpG gene

Properties
Regulog: HrcA - Bacillales
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -63
Score: 7.52063
Sequence: TTAGCACTCTAAACAAACGAGTGCTAA
Locus tag: ABC0970
Name: htpG
Funciton: Heat shock chaperone protein 90
htpG -63 7.5 TTAGCACTCTAAACAAACGAGTGCTAA ABC0970
Bacillus halodurans C-125
Position: -126
Score: 7.12565
Sequence: TTAGCACTCGTTGCTTGCAAGTGCTAA
Locus tag: BH1007
Name: htpG
Funciton: Heat shock chaperone protein 90
htpG -126 7.1 TTAGCACTCGTTGCTTGCAAGTGCTAA BH1007
Oceanobacillus iheyensis HTE831
Position: -52
Score: 7.61026
Sequence: TTAGCACTCGTAAGTAGTGAGTGCTAA
Locus tag: OB3158
Name: htpG
Funciton: Heat shock chaperone protein 90
htpG -52 7.6 TTAGCACTCGTAAGTAGTGAGTGCTAA OB3158
Paenibacillus sp. JDR-2
Position: -64
Score: 6.96768
Sequence: TTAGCACTCCAACACGGAGAGTGCTAA
Locus tag: Pjdr2_5425
Name: htpG
Funciton: Heat shock chaperone protein 90
htpG -64 7 TTAGCACTCCAACACGGAGAGTGCTAA Pjdr2_5425