Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing dnaK gene

Properties
Regulog: HrcA - Bacillales
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -42
Score: 7.37442
Sequence: TTAGCACTCGCTTTGTTAGAGTGCTAA
Locus tag: Aflv_0833
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: Aflv_0834
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Aflv_0835
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -42 7.4 TTAGCACTCGCTTTGTTAGAGTGCTAA Aflv_0833
Bacillus amyloliquefaciens FZB42
Position: -41
Score: 7.27227
Sequence: TTAGCACTCGCTGACCTTGAGTGCTAA
Locus tag: RBAM_023790
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: RBAM_023780
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: RBAM_023770
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -41 7.3 TTAGCACTCGCTGACCTTGAGTGCTAA RBAM_023790
Bacillus cereus ATCC 14579
Position: -43
Score: 7.43613
Sequence: TTAGCACTCAAAGACAAAGAGTGCTAA
Locus tag: BC4314
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: BC4313
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: BC4312
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -43 7.4 TTAGCACTCAAAGACAAAGAGTGCTAA BC4314
Bacillus clausii KSM-K16
Position: -41
Score: 7.50961
Sequence: TTAGCACTCGTTGCATTTGAGTGCTAA
Locus tag: ABC1657
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: ABC1658
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: ABC1659
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -41 7.5 TTAGCACTCGTTGCATTTGAGTGCTAA ABC1657
Bacillus halodurans C-125
Position: -114
Score: 7.32807
Sequence: TTAGCACTCGAACTATGAGAGTGCTAA
Locus tag: BH1344
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: BH1345
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: BH1346
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -114 7.3 TTAGCACTCGAACTATGAGAGTGCTAA BH1344
Bacillus licheniformis DSM 13
Position: -41
Score: 7.31968
Sequence: TTAGCACTCAGTTGTGCCGAGTGCTAA
Locus tag: BLi02741
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: BLi02740
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: BLi02739
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -41 7.3 TTAGCACTCAGTTGTGCCGAGTGCTAA BLi02741
Bacillus pumilus SAFR-032
Position: -41
Score: 7.52135
Sequence: TTAGCACTCGTTGAAAGAGAGTGCTAA
Locus tag: BPUM_2282
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: BPUM_2281
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: BPUM_2280
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -41 7.5 TTAGCACTCGTTGAAAGAGAGTGCTAA BPUM_2282
Bacillus subtilis subsp. subtilis str. 168
Position: -41
Score: 7.49622
Sequence: TTAGCACTCGCTTATTGAGAGTGCTAA
Locus tag: BSU25490
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: BSU25480
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: BSU25470
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -41 7.5 TTAGCACTCGCTTATTGAGAGTGCTAA BSU25490
Geobacillus kaustophilus HTA426
Position: -41
Score: 7.37013
Sequence: TTAGCACTCGAATTGTTCGAGTGCTAA
Locus tag: GK2506
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: GK2505
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: GK2504
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -41 7.4 TTAGCACTCGAATTGTTCGAGTGCTAA GK2506
Oceanobacillus iheyensis HTE831
Position: -41
Score: 7.36628
Sequence: TTAGCACTCAATAATCAAGAGTGCTAA
Locus tag: OB1970
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: OB1969
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: OB1968
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -41 7.4 TTAGCACTCAATAATCAAGAGTGCTAA OB1970
Paenibacillus sp. JDR-2
Position: -62
Score: 7.22184
Sequence: TTAGCACTCGGGCCTAATGAGTGCTAA
Locus tag: Pjdr2_2205
Name: hrcA
Funciton: Heat-inducible transcription repressor HrcA
Locus tag: Pjdr2_2206
Name: grpE
Funciton: Heat shock protein GrpE
Locus tag: Pjdr2_2207
Name: dnaK
Funciton: Chaperone protein DnaK
hrcA-grpE-dnaK -62 7.2 TTAGCACTCGGGCCTAATGAGTGCTAA Pjdr2_2205