Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing groEL gene

Properties
Regulog: HrcA - Bacillales
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Built upon 26 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -64
Score: 7.45775
Sequence: TTAGCACTCGACCGTAATGAGTGCTAA
Locus tag: Aflv_0211
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: Aflv_0212
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -64 7.5 TTAGCACTCGACCGTAATGAGTGCTAA Aflv_0211
Bacillus amyloliquefaciens FZB42
Position: -62
Score: 7.39734
Sequence: TTAGCACTCTTTAGAGCTGAGTGCTAA
Locus tag: RBAM_006470
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: RBAM_006480
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -62 7.4 TTAGCACTCTTTAGAGCTGAGTGCTAA RBAM_006470
Bacillus cereus ATCC 14579
Position: -67
Score: 7.17303
Sequence: TTAGCACTCGGATGACTTGAGTGCTAA
Locus tag: BC0294
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: BC0295
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -67 7.2 TTAGCACTCGGATGACTTGAGTGCTAA BC0294
Bacillus clausii KSM-K16
Position: -63
Score: 7.34742
Sequence: TTAGCACTCATCGAATCCGAGTGCTAA
Locus tag: ABC0881
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: ABC0882
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -63 7.3 TTAGCACTCATCGAATCCGAGTGCTAA ABC0881
Bacillus halodurans C-125
Position: -66
Score: 7.54257
Sequence: TTAGCACTCGTTTGAAGAGAGTGCTAA
Locus tag: BH0561
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: BH0562
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -66 7.5 TTAGCACTCGTTTGAAGAGAGTGCTAA BH0561
Bacillus licheniformis DSM 13
Position: -61
Score: 7.33115
Sequence: TTAGCACTCACCGAGTGCGAGTGCTAA
Locus tag: BLi00623
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: BLi00624
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -61 7.3 TTAGCACTCACCGAGTGCGAGTGCTAA BLi00623
Bacillus pumilus SAFR-032
Position: -65
Score: 7.51626
Sequence: TTAGCACTCACTGGTGATGAGTGCTAA
Locus tag: BPUM_0534
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: BPUM_0535
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -65 7.5 TTAGCACTCACTGGTGATGAGTGCTAA BPUM_0534
Bacillus subtilis subsp. subtilis str. 168
Position: -62
Score: 7.43196
Sequence: TTAGCACTCTTTAGTGCTGAGTGCTAA
Locus tag: BSU06020
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: BSU06030
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -62 7.4 TTAGCACTCTTTAGTGCTGAGTGCTAA BSU06020
Geobacillus kaustophilus HTA426
Position: -69
Score: 7.56189
Sequence: TTAGCACTCAATAGTGATGAGTGCTAA
Locus tag: GK0248
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: GK0249
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -69 7.6 TTAGCACTCAATAGTGATGAGTGCTAA GK0248
Oceanobacillus iheyensis HTE831
Position: -65
Score: 7.4502
Sequence: TTAGCACTCATCTATGAAGAGTGCTAA
Locus tag: OB0655
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: OB0656
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -65 7.5 TTAGCACTCATCTATGAAGAGTGCTAA OB0655
Paenibacillus sp. JDR-2
Position: -70
Score: 6.76064
Sequence: TTAGCACTTCAAGCTTACGAGTGCTAA
Locus tag: Pjdr2_1050
Name: groES
Funciton: Co-chaperonin GroES (HSP10 family)
Locus tag: Pjdr2_1051
Name: groEL
Funciton: Chaperonin GroEL (HSP60 family)
groES-groEL -70 6.8 TTAGCACTTCAAGCTTACGAGTGCTAA Pjdr2_1050