Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing abf6 gene

Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga petrophila RKU-1
Position: -221
Score: 5.74643
Position: -38
Score: 5.35162
Locus tag: Tpet_0637
Name: abf6
Funciton: Predicted Aapha-N-arabinofuranosidase (EC
Locus tag: Tpet_0638
Name: lamG1
Funciton: Laminin G domain-containing protein
Locus tag: Tpet_0639
Name: abf6
Funciton: Predicted Aapha-N-arabinofuranosidase (EC
Locus tag: Tpet_0640
Name: conA1
Funciton: Con A-like domain-containing protein
Locus tag: Tpet_0641
Name: conA2
Funciton: Con A-like domain-containing protein
Locus tag: Tpet_0642
Name: lamG2
Funciton: Laminin G domain-containing protein
abf6-lamG1-abf6-conA1-conA2-lamG2 -221 5.7 AGATAGGTACGTACCAATTT Tpet_0637
Thermotoga sp. RQ2
Position: -221
Score: 5.74643
Position: -38
Score: 5.35162
Locus tag: TRQ2_0662
Name: abf6
Funciton: Predicted Aapha-N-arabinofuranosidase (EC
Locus tag: TRQ2_0663
Name: lamG1
Funciton: Laminin G domain-containing protein
Locus tag: TRQ2_0664
Name: abf6
Funciton: Predicted Aapha-N-arabinofuranosidase (EC
Locus tag: TRQ2_0665
Name: conA1
Funciton: Con A-like domain-containing protein
Locus tag: TRQ2_0666
Name: conA2
Funciton: Con A-like domain-containing protein
Locus tag: TRQ2_0667
Name: lamG2
Funciton: Laminin G domain-containing protein
abf6-lamG1-abf6-conA1-conA2-lamG2 -221 5.7 AGATAGGTACGTACCAATTT TRQ2_0662