Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araF gene

Properties
Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -1498
Score: 6.28709
Sequence: ATAAAaGTACGTACCaTTAT
Position: -1396
Score: 4.7066
Sequence: ccAtcGGTACGTACCgTTAT
Locus tag: TM0278
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: TM0279
Name: araG
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
araF-araG -1498 6.3 ATAAAaGTACGTACCaTTAT TM0278
-1396 4.7 ccAtcGGTACGTACCgTTAT
Thermotoga neapolitana DSM 4359
Position: -136
Score: 6.18535
Sequence: ACAAAAGTACGTACCTTTAT
Position: -33
Score: 4.70179
Sequence: CAACTGGTACGTACCGATAT
Locus tag: CTN_0408
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: CTN_0406
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
araE-araF -136 6.2 ACAAAAGTACGTACCTTTAT CTN_0408
-33 4.7 CAACTGGTACGTACCGATAT
Thermotoga petrophila RKU-1
Position: -150
Score: 6.51559
Sequence: ATAAAAGTACGTACCTTTAT
Position: -48
Score: 4.7066
Sequence: CCATCGGTACGTACCGTTAT
Locus tag: Tpet_0647
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0646
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0645
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: Tpet_0644
Name: araG
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
araE-araE-araF-araG -150 6.5 ATAAAAGTACGTACCTTTAT Tpet_0647
-48 4.7 CCATCGGTACGTACCGTTAT
Thermotoga sp. RQ2
Position: -150
Score: 6.51559
Sequence: ATAAAAGTACGTACCTTTAT
Position: -48
Score: 4.7066
Sequence: CCATCGGTACGTACCGTTAT
Locus tag: TRQ2_0671
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: TRQ2_0670
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: TRQ2_0669
Name: araG
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
araE-araF-araG -150 6.5 ATAAAAGTACGTACCTTTAT TRQ2_0671
-48 4.7 CCATCGGTACGTACCGTTAT