Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araE gene

Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga naphthophila RKU-10
Position: -150
Score: 6.51559
Position: -48
Score: 4.7066
Locus tag: Tnap_0907
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
araE -150 6.5 ATAAAAGTACGTACCTTTAT Tnap_0907
Thermotoga neapolitana DSM 4359
Position: -136
Score: 6.18535
Position: -33
Score: 4.70179
Locus tag: CTN_0408
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: CTN_0406
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Thermotoga petrophila RKU-1
Position: -150
Score: 6.51559
Position: -48
Score: 4.7066
Locus tag: Tpet_0647
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0646
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: Tpet_0645
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: Tpet_0644
Name: araG
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
araE-araE-araF-araG -150 6.5 ATAAAAGTACGTACCTTTAT Tpet_0647
Thermotoga sp. RQ2
Position: -150
Score: 6.51559
Position: -48
Score: 4.7066
Locus tag: TRQ2_0671
Name: araE
Funciton: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
Locus tag: TRQ2_0670
Name: araF
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 1
Locus tag: TRQ2_0669
Name: araG
Funciton: Predicted arabinosides or arabinose ABC transport system, permease protein 2
araE-araF-araG -150 6.5 ATAAAAGTACGTACCTTTAT TRQ2_0671