Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing xylX gene

Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga petrophila RKU-1
Position: -233
Score: 5.35162
Position: -50
Score: 5.74643
Locus tag: Tpet_0636
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: Tpet_0635
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: Tpet_0634
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: Tpet_0633
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC
Locus tag: Tpet_0632
Name: xylX
Funciton: Secreted glycosyl hydrolase, similar to xylosidase
Locus tag: Tpet_0631
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
Locus tag: Tpet_0630
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: Tpet_0629
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: Tpet_0628
Name: araB
Funciton: Ribulokinase (EC
Locus tag: Tpet_0627
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW -233 5.4 CATTTTGTACGTACATATAT Tpet_0636
Thermotoga sp. RQ2
Position: -233
Score: 5.35162
Position: -50
Score: 5.74643
Locus tag: TRQ2_0661
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: TRQ2_0660
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: TRQ2_0659
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: TRQ2_0658
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC
Locus tag: TRQ2_0657
Name: xylX
Funciton: Secreted glycosyl hydrolase, similar to xylosidase
Locus tag: TRQ2_0656
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
Locus tag: TRQ2_0655
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: TRQ2_0654
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: TRQ2_0653
Name: araB
Funciton: Ribulokinase (EC
Locus tag: TRQ2_0652
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW -233 5.4 CATTTTGTACGTACATATAT TRQ2_0661