Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Tnap_0913 gene

Properties
Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga naphthophila RKU-10
Position: -56
Score: 4.89355
Sequence: TATAATGTACGTACCTATCA
Position: -55
Score: 5.03261
Sequence: GATAATATACGTACCTAAAT
Locus tag: Tnap_0910
Name: glsA
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: Tnap_0911
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Locus tag: Tnap_0912
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: Tnap_0913
Name: Tnap_0913
Funciton: predicted arabinose ABC transporter, sugar-binding protein
Locus tag: Tnap_0914
Name: Tnap_0914
Funciton: predicted arabinose ABC transporter, permease component
Locus tag: Tnap_0915
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Locus tag: Tnap_0916
Name: araB
Funciton: Ribulokinase (EC 2.7.1.16)
Locus tag: Tnap_0917
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
glsA-abfA-araM-Tnap_0913-Tnap_0914-araD-araB-araW -56 4.9 TATAATGTACGTACCTATCA Tnap_0910
-55 5 GATAATATACGTACCTAAAT