Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araB gene

Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: -169
Score: 4.99913
Locus tag: Tlet_1143
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: Tlet_1144
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: Tlet_1145
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: Tlet_1146
Name: xynB
Funciton: Endo-1,4-beta-xylanase
Locus tag: Tlet_1147
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC
Locus tag: Tlet_1148
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
Locus tag: Tlet_1149
Name: araA-II
Funciton: Predicted L-arabinose isomerase (EC
Locus tag: Tlet_1150
Name: araB
Funciton: Ribulokinase (EC
araN-II-araP-II-araQ-II-xynB-abf3-abfA-araA-II-araB -169 5 TAATTTGTATGTACATATAT Tlet_1143
Thermotoga maritima MSB8
Position: -44
Score: 5.93951
Locus tag: TM0280
Name: glsA
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: TM0281
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
Locus tag: TM0282
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: TM0283
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: TM0284
Name: araB
Funciton: Ribulokinase (EC
Locus tag: TM0285
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
glsA-abfA-araM-araD-araB-araW -44 5.9 AATAATGTACGTACCTAAAT TM0280
Thermotoga naphthophila RKU-10
Position: -56
Score: 4.89355
Position: -55
Score: 5.03261
Locus tag: Tnap_0910
Name: glsA
Funciton: Putative glycosyl hydrolase of unknown function (DUF1680)
Locus tag: Tnap_0911
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
Locus tag: Tnap_0912
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: Tnap_0913
Name: Tnap_0913
Funciton: predicted arabinose ABC transporter, sugar-binding protein
Locus tag: Tnap_0914
Name: Tnap_0914
Funciton: predicted arabinose ABC transporter, permease component
Locus tag: Tnap_0915
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: Tnap_0916
Name: araB
Funciton: Ribulokinase (EC
Locus tag: Tnap_0917
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
glsA-abfA-araM-Tnap_0913-Tnap_0914-araD-araB-araW -56 4.9 TATAATGTACGTACCTATCA Tnap_0910
Thermotoga petrophila RKU-1
Position: -233
Score: 5.35162
Position: -50
Score: 5.74643
Locus tag: Tpet_0636
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: Tpet_0635
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: Tpet_0634
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: Tpet_0633
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC
Locus tag: Tpet_0632
Name: xylX
Funciton: Secreted glycosyl hydrolase, similar to xylosidase
Locus tag: Tpet_0631
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
Locus tag: Tpet_0630
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: Tpet_0629
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: Tpet_0628
Name: araB
Funciton: Ribulokinase (EC
Locus tag: Tpet_0627
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW -233 5.4 CATTTTGTACGTACATATAT Tpet_0636
Thermotoga sp. RQ2
Position: -233
Score: 5.35162
Position: -50
Score: 5.74643
Locus tag: TRQ2_0661
Name: araN-II
Funciton: Predicted arabinose ABC transporter, substrate binding protein
Locus tag: TRQ2_0660
Name: araP-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 1
Locus tag: TRQ2_0659
Name: araQ-II
Funciton: Alpha-arabinosides ABC transport system, permease protein 2
Locus tag: TRQ2_0658
Name: abf3
Funciton: Alpha-N-arabinofuranosidase II (EC
Locus tag: TRQ2_0657
Name: xylX
Funciton: Secreted glycosyl hydrolase, similar to xylosidase
Locus tag: TRQ2_0656
Name: abfA
Funciton: Alpha-N-arabinofuranosidase (EC
Locus tag: TRQ2_0655
Name: araM
Funciton: L-arabinose-specific 1-epimerase (mutarotase)
Locus tag: TRQ2_0654
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC
Locus tag: TRQ2_0653
Name: araB
Funciton: Ribulokinase (EC
Locus tag: TRQ2_0652
Name: araW
Funciton: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
araN-II-araP-II-araQ-II-abf3-xylX-abfA-araM-araD-araB-araW -233 5.4 CATTTTGTACGTACATATAT TRQ2_0661