Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araR gene

Properties
Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga lettingae TMO
Position: 27
Score: 5.34936
Sequence: ATTTATGTACGTACGTTTAC
Locus tag: Tlet_1138
Name: araR
Funciton: Transcriptional repressor of arabinoside utilization operon, GntR family
Locus tag: Tlet_1139
Name: araD
Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araR-araD 27 5.3 ATTTATGTACGTACGTTTAC Tlet_1138