Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing araA gene

Properties
Regulog: AraR - Thermotogales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Built upon 35 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -164
Score: 4.7066
Sequence: ATAACGGTACGTACCGATGG
Position: -62
Score: 6.28709
Sequence: ATAATGGTACGTACTTTTAT
Locus tag: TM0276
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA -164 4.7 ATAACGGTACGTACCGATGG TM0276
-62 6.3 ATAATGGTACGTACTTTTAT
Thermotoga naphthophila RKU-10
Position: -164
Score: 4.7066
Sequence: ATAACGGTACGTACCGATGG
Position: -62
Score: 6.51559
Sequence: ATAAAGGTACGTACTTTTAT
Locus tag: Tnap_0906
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA -164 4.7 ATAACGGTACGTACCGATGG Tnap_0906
-62 6.5 ATAAAGGTACGTACTTTTAT
Thermotoga neapolitana DSM 4359
Position: -165
Score: 4.70179
Sequence: ATATCGGTACGTACCAGTTG
Position: -62
Score: 6.18535
Sequence: ATAAAGGTACGTACTTTTGT
Locus tag: CTN_0409
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA -165 4.7 ATATCGGTACGTACCAGTTG CTN_0409
-62 6.2 ATAAAGGTACGTACTTTTGT
Thermotoga petrophila RKU-1
Position: -164
Score: 4.7066
Sequence: ATAACGGTACGTACCGATGG
Position: -62
Score: 6.51559
Sequence: ATAAAGGTACGTACTTTTAT
Locus tag: Tpet_0648
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA -164 4.7 ATAACGGTACGTACCGATGG Tpet_0648
-62 6.5 ATAAAGGTACGTACTTTTAT
Thermotoga sp. RQ2
Position: -164
Score: 4.7066
Sequence: ATAACGGTACGTACCGATGG
Position: -62
Score: 6.51559
Sequence: ATAAAGGTACGTACTTTTAT
Locus tag: TRQ2_0672
Name: araA
Funciton: L-arabinose isomerase (EC 5.3.1.4)
araA -164 4.7 ATAACGGTACGTACCGATGG TRQ2_0672
-62 6.5 ATAAAGGTACGTACTTTTAT