Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing abfA1 gene

Properties
Regulog: BgaR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium dentium Bd1
Position: -169
Score: 6.03983
Sequence: ATATGTTTACGCAAACAAAA
Locus tag: BDP_0658
Name: abfA1
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
abfA1 -169 6 ATATGTTTACGCAAACAAAA BDP_0658
Bifidobacterium longum NCC2705
Position: -71
Score: 5.79325
Sequence: TTATGTTTACGCAAACACGA
Locus tag: BL1166
Name: abfA1
Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
abfA1 -71 5.8 TTATGTTTACGCAAACACGA BL1166