Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bgaX gene

Properties
Regulog: BgaR - Bifidobacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Built upon 22 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bifidobacterium animalis subsp. lactis AD011
Position: -83
Score: 6.37323
Sequence: ATATGTTTGCGCAAACATAA
Locus tag: BLA_0461
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
bgaX -83 6.4 ATATGTTTGCGCAAACATAA BLA_0461
Bifidobacterium breve DSM 20213
Position: -156
Score: 5.27378
Sequence: AGATGTTATCGCAACCATAG
Locus tag: BIFBRE_00764
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
bgaX -156 5.3 AGATGTTATCGCAACCATAG BIFBRE_00764
Bifidobacterium dentium Bd1
Position: -124
Score: 6.03983
Sequence: TTTTGTTTGCGTAAACATAT
Locus tag: BDP_0659
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
bgaX -124 6 TTTTGTTTGCGTAAACATAT BDP_0659
Bifidobacterium longum NCC2705
Position: -170
Score: 5.27378
Sequence: AGATGTTATCGCAACCATAG
Locus tag: BL1164
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
bgaX -170 5.3 AGATGTTATCGCAACCATAG BL1164